Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI894
Trapped Gene
Dpy30 (ENSMUSG00000024067)
Vector Insertion
Chr 17: 74699165 - 74707059
Public Clones BC0677 (sanger) D067F10 (ggtc) E091F02 (ggtc) D164G11 (ggtc) M124H07 (ggtc)
M124H07 (ggtc) E029B11 (ggtc) E091F02 (ggtc) D164G11 (ggtc) CMHD-GT_363C11-3 (cmhd)
CMHD-GT_264B8-3 (cmhd) CMHD-GT_533C1-3 (cmhd) CMHD-GT_179A10-3 (cmhd) CMHD-GT_458D5-3 (cmhd)
CMHD-GT_544D5-5S (cmhd) CMHD-GT_285G8-3 (cmhd) CMHD-GT_478C10-3 (cmhd) CMHD-GT_105H3-3 (cmhd)
CMHD-GT_399H1-3 (cmhd) CMHD-GT_447A12-3 (cmhd) CMHD-GT_356C11-3 (cmhd) CMHD-GT_479F10-3 (cmhd)
CMHD-GT_252H8-3 (cmhd) CMHD-GT_515F5-3 (cmhd) PSTVUpb14a4 (vanderbilt)
Private Clones OST465158 (lexicon) OST460045 (lexicon) OST453391 (lexicon) OST452248 (lexicon)
OST451293 (lexicon) OST447490 (lexicon) OST433696 (lexicon) OST429679 (lexicon)
OST411007 (lexicon) OST409607 (lexicon) OST408905 (lexicon) OST403580 (lexicon)
OST398730 (lexicon) OST385334 (lexicon) OST380898 (lexicon) OST360219 (lexicon)
OST353557 (lexicon) OST350086 (lexicon) OST340583 (lexicon) OST339577 (lexicon)
OST333576 (lexicon) OST325460 (lexicon) OST317117 (lexicon) OST304981 (lexicon)
OST267653 (lexicon) OST239265 (lexicon) OST225383 (lexicon) OST217751 (lexicon)
OST217152 (lexicon) OST194858 (lexicon) OST174437 (lexicon) OST168423 (lexicon)
OST151827 (lexicon) OST147672 (lexicon) OST131697 (lexicon) OST91340 (lexicon)
OST68854 (lexicon) OST60403 (lexicon) OST58807 (lexicon) OST54891 (lexicon)
OST37619 (lexicon) OST29891 (lexicon) OST24365 (lexicon) OST23155 (lexicon)
OST12243 (lexicon) OST8045 (lexicon) OST6300 (lexicon) OST514 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137928 (Chr17:74707060..74707202 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATCGAAACAGAAGGTGGA Chr17:74707147..74707166 59.22 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137928 (Chr17:74707060..74707202 -)
Downstram Exon
ENSMUSE00000692277 (Chr17:74698821..74699164 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATCGAAACAGAAGGTGGA Chr17:74707147..74707166 59.22 45 ATCTTCAAACTGCGCCTTGT Chr17:74699079..74699098 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692284 Chr17:74715685..74715761 GGGCACTTAGGAACCGACAG Chr17:74715696..74715715 61.96 60
upstream ENSMUSE00000137925 Chr17:74715384..74715456 ACTGGTATCCGGTTGATTGC Chr17:74715437..74715456 59.82 50
upstream ENSMUSE00000137924 Chr17:74715242..74715289 TGAGTACGGGCTCACAGACA Chr17:74715250..74715269 60.46 55
upstream ENSMUSE00000137928 Chr17:74707060..74707202 TCATCGAAACAGAAGGTGGA Chr17:74707147..74707166 59.22 45

*** Putative Vector Insertion (Chr 17: 74699165 - 74707059) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692277 Chr17:74698821..74699164 ATCTTCAAACTGCGCCTTGT Chr17:74699079..74699098 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGCCAAGGAAAGGTGAGA Chr17:74701052..74701072 60.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCCAAGGAAAGGTGAGA Chr17:74701052..74701072 60.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCTTGGGGATGGTACTCAC Chr17:74701224..74701244 59.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGACGTGACTGGGAAAACC Chr17:74701136..74701156 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024067