Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8980
Trapped Gene
Ddx3y (ENSMUSG00000069045)
Vector Insertion
Chr Y: 599811 - 600012
Public Clones RRE374 (baygenomics) RRC298 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568549 (ChrY:600013..600143 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAATAGCAGCCGAAGTAG ChrY:600045..600064 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568549 (ChrY:600013..600143 -)
Downstram Exon
ENSMUSE00000568548 (ChrY:598038..599810 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAATAGCAGCCGAAGTAG ChrY:600045..600064 60 55 AGCCTGCTGCTGCATAATCT ChrY:598807..598826 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568581 ChrY:622922..623020 GTGGCTGTTCCGTGAGAAGT ChrY:622985..623004 60.31 55
upstream ENSMUSE00000568580 ChrY:620765..620825 No primer for this exon
upstream ENSMUSE00000568579 ChrY:619344..619391 GGGCGCTATATACCTCCTCA ChrY:619370..619389 59.16 55
upstream ENSMUSE00000568575 ChrY:616753..616882 TCAGTGATCGTGGAAGTGGA ChrY:616764..616783 60.25 50
upstream ENSMUSE00000568572 ChrY:615866..616021 GCAAATTTGAACGGAGTGGT ChrY:615940..615959 59.98 45
upstream ENSMUSE00000568571 ChrY:615340..615439 TCTGGAGGAAACACAGGGATT ChrY:615409..615429 60.87 47.62
upstream ENSMUSE00000568567 ChrY:606148..606283 CTCGTCCTACTCCAGTGCAA ChrY:606206..606225 59.03 55
upstream ENSMUSE00000568565 ChrY:603546..603631 GATGGTCCAGGAGAGGCTTT ChrY:603559..603578 60.6 55
upstream ENSMUSE00000568561 ChrY:603038..603136 GGAAGATATGGTCGCCGTAA ChrY:603111..603130 59.92 50
upstream ENSMUSE00000568557 ChrY:602802..602962 GGGACTTAGAACGTGGATGC ChrY:602876..602895 59.56 55
upstream ENSMUSE00000568554 ChrY:602272..602416 AGGGGGTTCGTCACACTATG ChrY:602305..602324 59.84 55
upstream ENSMUSE00000568553 ChrY:602018..602162 CTGGCTGTAGGCAGAGTAGGA ChrY:602106..602126 59.65 57.14
upstream ENSMUSE00000568552 ChrY:601471..601652 GCAGATTCGCTGGAGAACTT ChrY:601589..601608 59.58 50
upstream ENSMUSE00000568551 ChrY:601284..601401 TGCCAAGCGATATTGAAGAA ChrY:601327..601346 59.4 40
upstream ENSMUSE00000568550 ChrY:600239..600392 GAAGTGCCTTCTTGGTTGGA ChrY:600293..600312 60.23 50
upstream ENSMUSE00000568549 ChrY:600013..600143 GCCAATAGCAGCCGAAGTAG ChrY:600045..600064 60 55

*** Putative Vector Insertion (Chr Y: 599811 - 600012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568548 ChrY:598038..599810 AGCCTGCTGCTGCATAATCT ChrY:598807..598826 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGCCACAACAGAGGATTTGG ChrY:600016..600037 60.12 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGCCACAACAGAGGATTTGG ChrY:600016..600037 60.12 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069045