Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8997
Trapped Gene
OTTMUSG00000016618 (ENSMUSG00000078889)
Vector Insertion
Chr 2: 175791665 - 175791869
Public Clones XF504 (baygenomics) XF180 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678801 (Chr2:175791870..175791996 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCAGGAAGAGTGGGCTTTG Chr2:175791940..175791959 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678801 (Chr2:175791870..175791996 -)
Downstram Exon
ENSMUSE00000678800 (Chr2:175791604..175791664 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCAGGAAGAGTGGGCTTTG Chr2:175791940..175791959 59.98 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678802 Chr2:175930121..175930258 TGCGTGACTCTACTGGGTGT Chr2:175930160..175930179 59.34 55
upstream ENSMUSE00000638779 Chr2:175922121..175922247 CTCAGGAAGAGTGGGCTTTG Chr2:175922191..175922210 59.98 55
upstream ENSMUSE00000638778 Chr2:175921854..175921914 No primer for this exon
upstream ENSMUSE00000678787 Chr2:175921854..175921914 No primer for this exon
upstream ENSMUSE00000678785 Chr2:175919491..175920700 GCAGTCATCTCGGAATCCAT Chr2:175920277..175920296 60.04 50
upstream ENSMUSE00000678786 Chr2:175918757..175919052 TTGCAGCAAGCATTGATCTC Chr2:175918950..175918969 60.1 45
upstream ENSMUSE00000678788 Chr2:175918100..175918139 No primer for this exon
upstream ENSMUSE00000678792 Chr2:175800091..175800160 TGCGTGACTCTACTGGGTGT Chr2:175800130..175800149 59.34 55
upstream ENSMUSE00000678797 Chr2:175800091..175800231 TGTGATGTGTTCTGCGTGAC Chr2:175800142..175800161 59.27 50
upstream ENSMUSE00000678813 Chr2:175800091..175800188 TGTGATGTGTTCTGCGTGAC Chr2:175800142..175800161 59.27 50
upstream ENSMUSE00000678801 Chr2:175791870..175791996 CTCAGGAAGAGTGGGCTTTG Chr2:175791940..175791959 59.98 55

*** Putative Vector Insertion (Chr 2: 175791665 - 175791869) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678800 Chr2:175791604..175791664 No primer for this exon
downstream ENSMUSE00000678791 Chr2:175788489..175791664 TTGGCACACGTGAAATTGTT Chr2:175790441..175790460 60.01 40
downstream ENSMUSE00000678799 Chr2:175788329..175788377 CTTGGCAGTATGGATTGTTTCA Chr2:175788323..175788344 60 40.91
downstream ENSMUSE00000678796 Chr2:175788064..175788377 TGATGAGCAAGAAGCAGAGG Chr2:175788046..175788065 59.27 50
downstream ENSMUSE00000678809 Chr2:175702719..175702856 TCACGCATAACACATCACACA Chr2:175702749..175702769 59.6 42.86
downstream ENSMUSE00000678812 Chr2:175694719..175694845 TCTGAGAAGCATCCAGCAAA Chr2:175694751..175694770 59.67 45
downstream ENSMUSE00000678808 Chr2:175694452..175694512 No primer for this exon
downstream ENSMUSE00000678811 Chr2:175694452..175694512 No primer for this exon
downstream ENSMUSE00000678804 Chr2:175693603..175694512 AACGTGAACAAACGCAAACA Chr2:175693624..175693643 60.19 40
downstream ENSMUSE00000678806 Chr2:175692089..175693298 TCGCTTATGGATTCCGAGAT Chr2:175692847..175692866 59.63 45
downstream ENSMUSE00000678807 Chr2:175691355..175691650 TCAATGCTTGCTGCAAAGAC Chr2:175691530..175691549 60.14 45
downstream ENSMUSE00000678810 Chr2:175690698..175690737 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:175791798..175791818 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078889