Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8998
Trapped Gene
Orc5l (ENSMUSG00000029012)
Vector Insertion
Chr 5: 21993036 - 22005793
Public Clones XF185 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000265982 (Chr5:22005794..22005906 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGGCCAAAATACAAATGC Chr5:22005829..22005848 59.67 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000265982 (Chr5:22005794..22005906 -)
Downstram Exon
ENSMUSE00000335364 (Chr5:21992308..21993035 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGGCCAAAATACAAATGC Chr5:22005829..22005848 59.67 40 GTGGCGCTCTCAAAATTCAT Chr5:21992304..21992323 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000266080 Chr5:22056010..22056161 ACTTTGCAGTCCCTGTTTGG Chr5:22056014..22056033 60.15 50
upstream ENSMUSE00000184457 Chr5:22053742..22053834 CATTTCAGCTTTCCGTCCAT Chr5:22053809..22053828 60.07 45
upstream ENSMUSE00000184467 Chr5:22052216..22052416 AGCAAGTGACCAGTGCTGAA Chr5:22052243..22052262 59.62 50
upstream ENSMUSE00000266054 Chr5:22043340..22043414 No primer for this exon
upstream ENSMUSE00000266044 Chr5:22039581..22039692 TTTCGTCCAAATACTGGATGC Chr5:22039621..22039641 59.95 42.86
upstream ENSMUSE00000184477 Chr5:22034973..22035103 CACTGTCTGTCGGGATCTGA Chr5:22034990..22035009 59.82 55
upstream ENSMUSE00000184474 Chr5:22032353..22032401 TCCCCAAATACTGTGAACCTG Chr5:22032368..22032388 59.84 47.62
upstream ENSMUSE00000184470 Chr5:22032181..22032271 CCTCACCTGAAGAAGGCAAT Chr5:22032211..22032230 59.28 50
upstream ENSMUSE00000266009 Chr5:22030634..22030686 CAGACCCAGGACAACTGAAAG Chr5:22030634..22030654 59.75 52.38
upstream ENSMUSE00000184472 Chr5:22029334..22029446 TGCTGCATACCTTGCCTCTT Chr5:22029372..22029391 60.93 50
upstream ENSMUSE00000184458 Chr5:22028209..22028256 No primer for this exon
upstream ENSMUSE00000184463 Chr5:22022522..22022632 AGAGTGGCTCCAACAGCAAA Chr5:22022535..22022554 60.97 50
upstream ENSMUSE00000265982 Chr5:22005794..22005906 ATGGGCCAAAATACAAATGC Chr5:22005829..22005848 59.67 40

*** Putative Vector Insertion (Chr 5: 21993036 - 22005793) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335364 Chr5:21992308..21993035 GTGGCGCTCTCAAAATTCAT Chr5:21992304..21992323 60.22 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAATTGTTAATCGCCTTGC Chr5:22005730..22005750 58.3 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGAAATCGTGACTGGGAAAA Chr5:22005728..22005749 59.42 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029012