Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9005
Trapped Gene
Ubqln4 (ENSMUSG00000008604)
Vector Insertion
Chr 3: 88369013 - 88369134
Public Clones XK101 (baygenomics) XK538 (baygenomics) XF207 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175599 (Chr3:88368929..88369012 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175599 (Chr3:88368929..88369012 +)
Downstram Exon
ENSMUSE00000175598 (Chr3:88369135..88369250 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398215 Chr3:88357638..88357834 No primer for this exon
upstream ENSMUSE00000175593 Chr3:88359260..88359411 No primer for this exon
upstream ENSMUSE00000175597 Chr3:88359712..88359914 No primer for this exon
upstream ENSMUSE00000175594 Chr3:88360579..88360841 No primer for this exon
upstream ENSMUSE00000175601 Chr3:88363540..88363698 No primer for this exon
upstream ENSMUSE00000175600 Chr3:88367030..88367255 No primer for this exon
upstream ENSMUSE00000175596 Chr3:88368292..88368431 No primer for this exon
upstream ENSMUSE00000175599 Chr3:88368929..88369012 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88369013 - 88369134) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175598 Chr3:88369135..88369250 No primer for this exon
downstream ENSMUSE00000175591 Chr3:88369613..88369799 No primer for this exon
downstream ENSMUSE00000347364 Chr3:88372003..88373647 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCAGGTGAGTGAGGTTCA Chr3:88369008..88369028 60.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCAGGTGAGTGAGGTTCA Chr3:88369008..88369028 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008604