Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9019
Trapped Gene
Cfdp1 (ENSMUSG00000031954)
Vector Insertion
Chr 8: 114303310 - 114354769
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
XF586 (baygenomics) P030H01 (ggtc) E080C12 (ggtc) E027D08 (ggtc)
D105A07 (ggtc) D019B07 (ggtc) W266E08 (ggtc) P099E07 (ggtc) E045D12 (ggtc)
D177E01 (ggtc) D082B08 (ggtc) D007F09 (ggtc) 3SE305A11 (ggtc) D010E01 (ggtc)
W195D07 (ggtc) E104B11 (ggtc) E036C04 (ggtc) D109E08 (ggtc) D076F07 (ggtc)
(ggtc) Q021F06 (ggtc) P131H02 (ggtc) E047G09 (ggtc) D184E04 (ggtc)
D103G11 (ggtc) D010E01 (ggtc) P131F08 (ggtc) W245B07 (ggtc) E326H10 (ggtc)
E044F02 (ggtc) D142G04 (ggtc) D082B08 (ggtc) D007F09 (ggtc) P028A09 (ggtc)
E104B11 (ggtc) E031D08 (ggtc) D105A07 (ggtc) D019B07 (ggtc) P006H08 (ggtc)
P131H02 (ggtc) E047F08 (ggtc) D184E04 (ggtc) D103E07 (ggtc) D007H06 (ggtc)
5SE305A11 (ggtc) P131H02 (ggtc) M074A08 (ggtc) E326H10 (ggtc) E036C04 (ggtc)
D135G02 (ggtc) D076F07 (ggtc) (ggtc) CMHD-GT_323G4-3 (cmhd) CMHD-GT_428B10-3 (cmhd)
CMHD-GT_505E4-3 (cmhd) CMHD-GT_504B2-3 (cmhd) CMHD-GT_268D3-3 (cmhd) CMHD-GT_540G2-5S (cmhd)
(cmhd) CMHD-GT_537E3-5S (cmhd) CMHD-GT_477G11-3 (cmhd) CMHD-GT_340H6-3 (cmhd)
CMHD-GT_540G2-3 (cmhd) CMHD-GT_504A7-3 (cmhd) CMHD-GT_268A4-3 (cmhd) CMHD-GT_517B11-5S (cmhd)
CMHD-GT_510C2-3 (cmhd) (cmhd) CMHD-GT_352E5-3 (cmhd) CMHD-GT_537D5-5S (cmhd)
CMHD-GT_523D1-3 (cmhd) CMHD-GT_268B10-3 (cmhd) CMHD-GT_534F4-3 (cmhd) CMHD-GT_495E4-3 (cmhd)
CMHD-GT_298C4-3 (cmhd) CMHD-GT_534F4-5S (cmhd) CMHD-GT_542E2-5S (cmhd) FHCRC-GT-S13-3B1 (fhcrc)
FHCRC-GT-S5-9A1 (fhcrc) FHCRC-GT-S23-5F1 (fhcrc) IST10045H5 (tigm)
IST10478E5 (tigm) IST14890H8 (tigm) IST10827G7 (tigm) IST14350D9 (tigm)
IST11217G1 (tigm) IST12827G9 (tigm) IST12444C10 (tigm) IST13930C12 (tigm)
IST12067A6 (tigm) IST13907C11 (tigm) IST10824E6 (tigm) IST14507F10 (tigm)
IST12698H1 (tigm) IST14418E5 (tigm) IST14700B1 (tigm) IST10171B8 (tigm)
IST14709E3 (tigm) IST11426E9 (tigm) IST14008G5 (tigm) IST10138H5 (tigm)
IST12272G7 (tigm) IST14674C5 (tigm) IST12706E9 (tigm) IST13517G4 (tigm)
IST10418H5 (tigm) IST13930C12 (tigm) IST10574H10 (tigm) IST10824E6 (tigm)
IST12272G7 (tigm) IST14345D8 (tigm) IST14538C6 (tigm) IST14345D8 (tigm)
IST11654B2 (tigm) IST12673C4 (tigm) IST12673B4 (tigm) IST13927H3 (tigm)
IST10536G4 (tigm) IST12673B4 (tigm) IST13964G11 (tigm) IST14886A9 (tigm)
IST10466D5 (tigm) IST13554C3 (tigm) IST10260D9 (tigm) IST12444C10 (tigm)
IST10187F4 (tigm) IST12067A6 (tigm) IST14817G9 (tigm) IST11156A1 (tigm)
IST13517H5 (tigm) IST10322A12 (tigm) IST13066F11 (tigm)
Private Clones OST500030 (lexicon) OST469261 (lexicon) OST469252 (lexicon) OST463743 (lexicon)
OST459970 (lexicon) OST459952 (lexicon) OST458833 (lexicon) OST457932 (lexicon)
OST457931 (lexicon) OST457930 (lexicon) OST456320 (lexicon) OST449980 (lexicon)
OST447464 (lexicon) OST442044 (lexicon) OST434792 (lexicon) OST432946 (lexicon)
OST432945 (lexicon) OST427431 (lexicon) OST426628 (lexicon) OST426626 (lexicon)
OST426585 (lexicon) OST416578 (lexicon) OST413943 (lexicon) OST410750 (lexicon)
OST397645 (lexicon) OST395063 (lexicon) OST393247 (lexicon) OST392952 (lexicon)
OST392525 (lexicon) OST390776 (lexicon) OST390273 (lexicon) OST385979 (lexicon)
OST381860 (lexicon) OST380395 (lexicon) OST374527 (lexicon) OST373854 (lexicon)
OST366669 (lexicon) OST366284 (lexicon) OST364459 (lexicon) OST361865 (lexicon)
OST361004 (lexicon) OST360217 (lexicon) OST359023 (lexicon) OST359019 (lexicon)
OST357496 (lexicon) OST351431 (lexicon) OST349595 (lexicon) OST349384 (lexicon)
OST344606 (lexicon) OST343644 (lexicon) OST330509 (lexicon) OST330196 (lexicon)
OST328573 (lexicon) OST322727 (lexicon) OST320768 (lexicon) OST318728 (lexicon)
OST318698 (lexicon) OST313918 (lexicon) OST313704 (lexicon) OST311569 (lexicon)
OST304225 (lexicon) OST302025 (lexicon) OST301515 (lexicon) OST301509 (lexicon)
OST298173 (lexicon) OST293434 (lexicon) OST292633 (lexicon) OST287526 (lexicon)
OST285592 (lexicon) OST282766 (lexicon) OST274390 (lexicon) OST274389 (lexicon)
OST274388 (lexicon) OST273891 (lexicon) OST273291 (lexicon) OST271278 (lexicon)
OST269624 (lexicon) OST262420 (lexicon) OST257563 (lexicon) OST237683 (lexicon)
OST210840 (lexicon) OST207373 (lexicon) OST202939 (lexicon) OST197633 (lexicon)
OST194203 (lexicon) OST191768 (lexicon) OST187333 (lexicon) OST169995 (lexicon)
OST165328 (lexicon) OST160865 (lexicon) OST158055 (lexicon) OST155143 (lexicon)
OST155047 (lexicon) OST148641 (lexicon) OST148537 (lexicon) OST140198 (lexicon)
OST138001 (lexicon) OST136417 (lexicon) OST133832 (lexicon) OST133119 (lexicon)
OST129191 (lexicon) OST129095 (lexicon) OST128944 (lexicon) OST126546 (lexicon)
OST123814 (lexicon) OST123794 (lexicon) OST115564 (lexicon) OST111689 (lexicon)
OST99684 (lexicon) OST97669 (lexicon) OST96125 (lexicon) OST80774 (lexicon)
OST77468 (lexicon) OST72730 (lexicon) OST71334 (lexicon) OST71226 (lexicon)
OST68823 (lexicon) OST68785 (lexicon) OST67673 (lexicon) OST67671 (lexicon)
OST67431 (lexicon) OST66227 (lexicon) OST64319 (lexicon) OST57634 (lexicon)
OST55569 (lexicon) OST50836 (lexicon) OST50411 (lexicon) OST45318 (lexicon)
OST44662 (lexicon) OST43290 (lexicon) OST43276 (lexicon) OST42037 (lexicon)
OST40181 (lexicon) OST38857 (lexicon) OST38854 (lexicon) OST37911 (lexicon)
OST37665 (lexicon) OST37493 (lexicon) OST36605 (lexicon) OST34386 (lexicon)
OST34045 (lexicon) OST33708 (lexicon) OST33077 (lexicon) OST33070 (lexicon)
OST32509 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214935 (Chr8:114354770..114354889 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCGTCTAAGGAAGCGAAGT Chr8:114354849..114354868 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214935 (Chr8:114354770..114354889 -)
Downstram Exon
ENSMUSE00000214933 (Chr8:114303151..114303309 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCGTCTAAGGAAGCGAAGT Chr8:114354849..114354868 60.15 50 TGGATTTCTCAAGGGTGCTC Chr8:114303205..114303224 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363488 Chr8:114378044..114378210 CTGCTGGTCCTGTACCCCTA Chr8:114378189..114378208 60.13 60
upstream ENSMUSE00000214930 Chr8:114368994..114369111 GCAGGCTGAGAAAACCAAAG Chr8:114369028..114369047 59.99 50
upstream ENSMUSE00000214932 Chr8:114365683..114365890 AGCCCCAGGTTCACAAACTA Chr8:114365685..114365704 59.59 50
upstream ENSMUSE00000214931 Chr8:114364258..114364385 TTCGCTGGCGAAGAAGTAAG Chr8:114364258..114364277 60.65 50
upstream ENSMUSE00000214935 Chr8:114354770..114354889 TGCGTCTAAGGAAGCGAAGT Chr8:114354849..114354868 60.15 50

*** Putative Vector Insertion (Chr 8: 114303310 - 114354769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214933 Chr8:114303151..114303309 TGGATTTCTCAAGGGTGCTC Chr8:114303205..114303224 60.19 50
downstream ENSMUSE00000392401 Chr8:114292373..114292687 GGTCCACTCGATCCAGAAAA Chr8:114292628..114292647 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGGCACACTGGGAAAACT Chr8:114333720..114333740 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCGTGACTGGGAAAACC Chr8:114333702..114333722 62.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTGGACTACAGTGCAAGACC Chr8:114333879..114333900 59.78 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCTCTCGTGACTGGGAAAA Chr8:114333825..114333845 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031954