Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9030
Trapped Gene
B4galt1 (ENSMUSG00000028413)
Vector Insertion
Chr 4: 40770708 - 40800423
Public Clones (sanger) (sanger) (sanger) RST557 (baygenomics) G045D03 (ggtc)
E324E06 (ggtc) E323E04 (ggtc) G056E05 (ggtc) E323A08 (ggtc) CMHD-GT_437A7-3 (cmhd)
CMHD-GT_536G9-3 (cmhd) CMHD-GT_349D9-3 (cmhd) (cmhd) CMHD-GT_535C2-3 (cmhd)
CMHD-GT_341B3-3 (cmhd) CMHD-GT_536G9-5S (cmhd) IST14186G4 (tigm) IST14302G9 (tigm)
IST11857C4 (tigm) IST14298F2 (tigm) IST10054B3 (tigm) IST14982G8 (tigm)
IST12930B7 (tigm)
Private Clones OST436505 (lexicon) OST431044 (lexicon) OST404275 (lexicon) OST374715 (lexicon)
OST353330 (lexicon) OST349486 (lexicon) OST347470 (lexicon) OST341880 (lexicon)
OST277024 (lexicon) OST275200 (lexicon) OST194395 (lexicon) OST135458 (lexicon)
OST132721 (lexicon) OST132357 (lexicon) OST43217 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000437529 (Chr4:40800424..40801031 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCGTCACCCTCGTCTATTA Chr4:40800717..40800736 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000437529 (Chr4:40800424..40801031 -)
Downstram Exon
ENSMUSE00000178953 (Chr4:40770472..40770707 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCGTCACCCTCGTCTATTA Chr4:40800717..40800736 60.1 55 GGTTACGGAATGGGATGATG Chr4:40770539..40770558 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437529 Chr4:40800424..40801031 GGCGTCACCCTCGTCTATTA Chr4:40800717..40800736 60.1 55

*** Putative Vector Insertion (Chr 4: 40770708 - 40800423) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000178953 Chr4:40770472..40770707 GGTTACGGAATGGGATGATG Chr4:40770539..40770558 60.01 50
downstream ENSMUSE00000178949 Chr4:40759718..40759905 AAACCCGAACTTGTCCATTG Chr4:40759698..40759717 59.83 45
downstream ENSMUSE00000178956 Chr4:40756712..40756834 CCATTGATGGCAAGAAACTG Chr4:40756744..40756763 59.12 45
downstream ENSMUSE00000675552 Chr4:40756359..40756437 AAGCTCTTGTGCTTGCAGGT Chr4:40756339..40756358 60.2 50
downstream ENSMUSE00000178955 Chr4:40754766..40754870 CTCTTGAATGCCGGATCATT Chr4:40754772..40754791 60.04 45
downstream ENSMUSE00000297378 Chr4:40751635..40754350 CATGTTGACACCAGGGTGAG Chr4:40751918..40751937 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGAAAGAGAGGCCCTGCTG Chr4:40800450..40800471 63.24 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGAAAGAGAGGCCCTGCTG Chr4:40800450..40800471 63.24 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGGCTAGTGTGAGCCTCTG Chr4:40800995..40801015 59.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAGGGAGACTCAAAGAAGCTGA Chr4:40801011..40801033 59.64 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028413