Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9084
Trapped Gene
Uhrf1 (ENSMUSG00000001228)
Vector Insertion
Chr 17: 56459966 - 56461443
Public Clones XK123 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139532 (Chr17:56459820..56459965 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139532 (Chr17:56459820..56459965 +)
Downstram Exon
ENSMUSE00000139536 (Chr17:56461444..56461548 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694051 Chr17:56442823..56442984 No primer for this exon
upstream ENSMUSE00000515939 Chr17:56442840..56442984 No primer for this exon
upstream ENSMUSE00000694033 Chr17:56443736..56443816 No primer for this exon
upstream ENSMUSE00000694053 Chr17:56443771..56443816 No primer for this exon
upstream ENSMUSE00000292948 Chr17:56444509..56444673 No primer for this exon
upstream ENSMUSE00000721913 Chr17:56444509..56444673 No primer for this exon
upstream ENSMUSE00000292918 Chr17:56448760..56449002 No primer for this exon
upstream ENSMUSE00000139530 Chr17:56450099..56450259 No primer for this exon
upstream ENSMUSE00000139535 Chr17:56451477..56451692 No primer for this exon
upstream ENSMUSE00000139534 Chr17:56452287..56452390 No primer for this exon
upstream ENSMUSE00000139545 Chr17:56452464..56452674 No primer for this exon
upstream ENSMUSE00000694050 Chr17:56452488..56452674 No primer for this exon
upstream ENSMUSE00000139542 Chr17:56454615..56454738 No primer for this exon
upstream ENSMUSE00000139540 Chr17:56454822..56454929 No primer for this exon
upstream ENSMUSE00000139531 Chr17:56455200..56455304 No primer for this exon
upstream ENSMUSE00000139541 Chr17:56456427..56456533 No primer for this exon
upstream ENSMUSE00000139537 Chr17:56457414..56457573 No primer for this exon
upstream ENSMUSE00000139529 Chr17:56457670..56457807 No primer for this exon
upstream ENSMUSE00000139538 Chr17:56459585..56459705 No primer for this exon
upstream ENSMUSE00000139532 Chr17:56459820..56459965 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56459966 - 56461443) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139536 Chr17:56461444..56461548 No primer for this exon
downstream ENSMUSE00000346806 Chr17:56461779..56462909 No primer for this exon
downstream ENSMUSE00000694055 Chr17:56461779..56462908 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTGGGATGATGTGCTAA Chr17:56459927..56459947 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTGGGATGATGTGCTAA Chr17:56459927..56459947 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001228