Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9088
Trapped Gene
Nasp (ENSMUSG00000028693)
Vector Insertion
Chr 4: 116274826 - 116275330
Public Clones XK218 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000181403 (Chr4:116275331..116275408 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGCGCTTCCTCATCAAAT Chr4:116275367..116275386 61.87 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000181403 (Chr4:116275331..116275408 -)
Downstram Exon
ENSMUSE00000181396 (Chr4:116274697..116274825 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGCGCTTCCTCATCAAAT Chr4:116275367..116275386 61.87 45 CACTGCCTCCATTCACCTCT Chr4:116274725..116274744 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000407904 Chr4:116300495..116300556 GCGTTTCCATCCGTTAAGAC Chr4:116300530..116300549 59.57 50
upstream ENSMUSE00000181400 Chr4:116299937..116300034 CGATGGCCACAGAGTCTACA Chr4:116299978..116299997 59.85 55
upstream ENSMUSE00000505449 Chr4:116299937..116300102 TCTGCTGTCCGGAATTCTCT Chr4:116300049..116300068 59.95 50
upstream ENSMUSE00000525389 Chr4:116299937..116300083 TCTGCTGTCCGGAATTCTCT Chr4:116300049..116300068 59.95 50
upstream ENSMUSE00000181395 Chr4:116295372..116295419 CCTCGGCAGATAAAATGGAG Chr4:116295374..116295393 59.66 50
upstream ENSMUSE00000181391 Chr4:116291475..116291585 ACATCTGGTGATGGGTGACA Chr4:116291518..116291537 59.8 50
upstream ENSMUSE00000181404 Chr4:116286935..116287015 GAAACGGCTAATGAGTGTGGA Chr4:116286979..116286999 60.12 47.62
upstream ENSMUSE00000181402 Chr4:116284577..116284686 TGCCTTAGAAGGAGTGCATGT Chr4:116284642..116284662 59.89 47.62
upstream ENSMUSE00000470333 Chr4:116283008..116283982 TCAAGTCAAGTCAGCGGATG Chr4:116283473..116283492 59.98 50
upstream ENSMUSE00000259672 Chr4:116278289..116278368 CAAGGCTGAAGAAACACCAA Chr4:116278312..116278331 58.9 45
upstream ENSMUSE00000259667 Chr4:116277514..116277599 AACTTGCCTGGGATATGCTG Chr4:116277540..116277559 60.1 50
upstream ENSMUSE00000259660 Chr4:116277346..116277419 CTGCACAAGCCCATCTTAAA Chr4:116277371..116277390 58.92 45
upstream ENSMUSE00000259655 Chr4:116276768..116276956 GCCTAAGCCTGCAAGAACAA Chr4:116276901..116276920 60.52 50
upstream ENSMUSE00000181393 Chr4:116276500..116276666 AGGCCGAAGGATCGTTTACT Chr4:116276623..116276642 60.1 50
upstream ENSMUSE00000181399 Chr4:116275493..116275549 GCTGGTGCCTCAGTATCCAT Chr4:116275494..116275513 60.1 55
upstream ENSMUSE00000181403 Chr4:116275331..116275408 ATGGCGCTTCCTCATCAAAT Chr4:116275367..116275386 61.87 45

*** Putative Vector Insertion (Chr 4: 116274826 - 116275330) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000181396 Chr4:116274697..116274825 CACTGCCTCCATTCACCTCT Chr4:116274725..116274744 60.26 55
downstream ENSMUSE00000631434 Chr4:116274214..116274398 TTGGCTCTCAGCCTGATTCT Chr4:116274353..116274372 60.1 50
downstream ENSMUSE00000475846 Chr4:116273657..116274398 TTTAGCAGACCCCATCCAAG Chr4:116273945..116273964 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCTGCATTTAATCGCCTTG Chr4:116275268..116275289 61.13 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCAATGTCTGCATTCGTGA Chr4:116275274..116275295 60.25 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028693