Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9104
Trapped Gene
B230112C05Rik (ENSMUSG00000041817)
Vector Insertion
Chr 13: 97867667 - 97876908
Public Clones (sanger) XK517 (baygenomics) D063C11 (ggtc) D063C11 (ggtc)
Private Clones OST360783 (lexicon) OST311408 (lexicon) OST308181 (lexicon) OST41872 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297802 (Chr13:97867495..97867666 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCCGTTGGGTTTTATTC Chr13:97867633..97867652 60.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297802 (Chr13:97867495..97867666 +)
Downstram Exon
ENSMUSE00000569672 (Chr13:97876909..97877088 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCCGTTGGGTTTTATTC Chr13:97867633..97867652 60.67 50 AGCCCCAAATCTTTTCCTCT Chr13:97877008..97877027 59.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611533 Chr13:97841598..97841666 No primer for this exon
upstream ENSMUSE00000297815 Chr13:97861773..97861907 GATAACTGCACGCATGAGGA Chr13:97861800..97861819 59.83 50
upstream ENSMUSE00000297810 Chr13:97863546..97863645 TTTGCGCCTGAAGATTCTCT Chr13:97863621..97863640 60.1 45
upstream ENSMUSE00000297805 Chr13:97864017..97864102 GGTGGGCCATTGATGATATT Chr13:97864044..97864063 59.47 45
upstream ENSMUSE00000297802 Chr13:97867495..97867666 GAGGCCGTTGGGTTTTATTC Chr13:97867633..97867652 60.67 50

*** Putative Vector Insertion (Chr 13: 97867667 - 97876908) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569672 Chr13:97876909..97877088 AGCCCCAAATCTTTTCCTCT Chr13:97877008..97877027 59.17 45
downstream ENSMUSE00000569671 Chr13:97879978..97880106 TGACTGGTACTCGCTGATGC Chr13:97880073..97880092 60.02 55
downstream ENSMUSE00000297785 Chr13:97881251..97881357 GAGTGTCGTCCAGTCCAGGT Chr13:97881343..97881362 60.16 60
downstream ENSMUSE00000297780 Chr13:97883594..97883633 GGCATCTTTTAGGGAATGGA Chr13:97883617..97883636 58.97 45
downstream ENSMUSE00000297775 Chr13:97884064..97884214 GTACGCGTGGAAACAGGAGT Chr13:97884097..97884116 60.18 55
downstream ENSMUSE00000297771 Chr13:97888330..97888486 CTCTGATGTTCGTGCAGCAT Chr13:97888360..97888379 60.02 50
downstream ENSMUSE00000297764 Chr13:97892647..97892847 CTGGTGGAGTCCTCGTCTTC Chr13:97892735..97892754 59.83 60
downstream ENSMUSE00000397821 Chr13:97896451..97899470 GGCGCGTCTTCAAGTTCTAC Chr13:97896782..97896801 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTAATCGCCTTGCAGCAC Chr13:97873715..97873735 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCCGTTGGGTTTTATTC Chr13:97873634..97873654 60.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041817