Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9105
Trapped Gene
Crtc1 (ENSMUSG00000003575)
Vector Insertion
Chr 8: 72929220 - 72929976
Public Clones XK522 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000509969 (Chr8:72929977..72930114 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000509969 (Chr8:72929977..72930114 -)
Downstram Exon
ENSMUSE00000482304 (Chr8:72929158..72929219 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471237 Chr8:72963332..72963469 No primer for this exon
upstream ENSMUSE00000503103 Chr8:72932794..72932910 No primer for this exon
upstream ENSMUSE00000509969 Chr8:72929977..72930114 No primer for this exon

*** Putative Vector Insertion (Chr 8: 72929220 - 72929976) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482304 Chr8:72929158..72929219 No primer for this exon
downstream ENSMUSE00000510163 Chr8:72926330..72926424 No primer for this exon
downstream ENSMUSE00000512262 Chr8:72924518..72924603 No primer for this exon
downstream ENSMUSE00000514329 Chr8:72922195..72922235 No primer for this exon
downstream ENSMUSE00000455927 Chr8:72921645..72921853 No primer for this exon
downstream ENSMUSE00000516330 Chr8:72916821..72916954 No primer for this exon
downstream ENSMUSE00000517104 Chr8:72915760..72916062 No primer for this exon
downstream ENSMUSE00000518318 Chr8:72915101..72915202 No primer for this exon
downstream ENSMUSE00000519534 Chr8:72911974..72912060 No primer for this exon
downstream ENSMUSE00000520312 Chr8:72911440..72911620 No primer for this exon
downstream ENSMUSE00000521066 Chr8:72906256..72910234 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGGAACAGGGGACATAA Chr8:72929922..72929942 61.08 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACGTGACTGGGAAAACC Chr8:72929909..72929929 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003575