Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9113
Trapped Gene
Rod1 (ENSMUSG00000028382)
Vector Insertion
Chr 4: 59507483 - 59514241
Public Clones XK552 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673466 (Chr4:59514242..59514346 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATTGCTACCTGGGCAGAG Chr4:59514246..59514265 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673466 (Chr4:59514242..59514346 -)
Downstram Exon
ENSMUSE00000178590 (Chr4:59507372..59507482 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATTGCTACCTGGGCAGAG Chr4:59514246..59514265 60.28 55 ACTGGGTCGGCATACTGAAG Chr4:59507372..59507391 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000478083 Chr4:59562020..59562168 TTTCCCACTCTTCCTTCCAC Chr4:59562147..59562166 59.11 50
upstream ENSMUSE00000662907 Chr4:59562020..59562146 No primer for this exon
upstream ENSMUSE00000662906 Chr4:59559021..59559054 No primer for this exon
upstream ENSMUSE00000673510 Chr4:59537727..59537769 No primer for this exon
upstream ENSMUSE00000673509 Chr4:59537689..59537696 No primer for this exon
upstream ENSMUSE00000662905 Chr4:59537276..59537348 GGGGATCTGATGAGCTTCTG Chr4:59537328..59537347 59.76 55
upstream ENSMUSE00000673513 Chr4:59537276..59537297 No primer for this exon
upstream ENSMUSE00000435680 Chr4:59537267..59537348 ACAGCTCGACTTCTGCAGGT Chr4:59537274..59537293 60.21 55
upstream ENSMUSE00000673508 Chr4:59537267..59537348 ACAGCTCGACTTCTGCAGGT Chr4:59537274..59537293 60.21 55
upstream ENSMUSE00000709664 Chr4:59530458..59530627 GTCACCGAAGCAGAGGTCAT Chr4:59530519..59530538 60.27 55
upstream ENSMUSE00000719768 Chr4:59530458..59530627 GTCACCGAAGCAGAGGTCAT Chr4:59530519..59530538 60.27 55
upstream ENSMUSE00000178604 Chr4:59527146..59527292 No primer for this exon
upstream ENSMUSE00000673470 Chr4:59527146..59527292 No primer for this exon
upstream ENSMUSE00000673466 Chr4:59514242..59514346 ACATTGCTACCTGGGCAGAG Chr4:59514246..59514265 60.28 55
upstream ENSMUSE00000178593 Chr4:59514182..59514346 ACATTGCTACCTGGGCAGAG Chr4:59514246..59514265 60.28 55

*** Putative Vector Insertion (Chr 4: 59507483 - 59514241) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000178590 Chr4:59507372..59507482 ACTGGGTCGGCATACTGAAG Chr4:59507372..59507391 60.13 55
downstream ENSMUSE00000178591 Chr4:59506058..59506232 GTGCAGCACGCATTGTAGAT Chr4:59506173..59506192 59.9 50
downstream ENSMUSE00000178601 Chr4:59500983..59501060 CCCTGCATATGGAGAGGACA Chr4:59501004..59501023 61.03 55
downstream ENSMUSE00000178603 Chr4:59498479..59498618 ATTCCCAGGCATACCACTTG Chr4:59498490..59498509 59.81 50
downstream ENSMUSE00000178596 Chr4:59498211..59498244 AAAGCCCATGTGGTGTGATA Chr4:59498201..59498220 58.85 45
downstream ENSMUSE00000322823 Chr4:59495417..59495509 CACCAAGGCGTTTTCTTTCT Chr4:59495426..59495445 59.35 45
downstream ENSMUSE00000322814 Chr4:59494234..59494450 GGCTTTTTAAAGCGATGCAG Chr4:59494275..59494294 59.99 45
downstream ENSMUSE00000322804 Chr4:59490027..59490104 AGCCTTCACTGAGCATCCAG Chr4:59490019..59490038 60.56 55
downstream ENSMUSE00000662904 Chr4:59488134..59489887 GGGGACAACTGCAACACTTT Chr4:59489050..59489069 60.01 50
downstream ENSMUSE00000386309 Chr4:59487938..59489887 GGGGACAACTGCAACACTTT Chr4:59489050..59489069 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGAAGTTAATCGCCTTGC Chr4:59514178..59514198 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGGCACATTGCTACCTG Chr4:59514251..59514271 59.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028382