Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9131
Trapped Gene
Lama5 (ENSMUSG00000015647)
Vector Insertion
Chr 2: 179937213 - 179941429
Public Clones RST396 (baygenomics) RST397 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678443 (Chr2:179941430..179941527 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678443 (Chr2:179941430..179941527 -)
Downstram Exon
ENSMUSE00000678442 (Chr2:179937097..179937212 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717239 Chr2:179960196..179960564 No primer for this exon
upstream ENSMUSE00000719761 Chr2:179960196..179960564 No primer for this exon
upstream ENSMUSE00000226035 Chr2:179955931..179956083 No primer for this exon
upstream ENSMUSE00000678447 Chr2:179955931..179956083 No primer for this exon
upstream ENSMUSE00000226030 Chr2:179942959..179943076 No primer for this exon
upstream ENSMUSE00000678446 Chr2:179942959..179943076 No primer for this exon
upstream ENSMUSE00000170633 Chr2:179941892..179942010 No primer for this exon
upstream ENSMUSE00000678445 Chr2:179941892..179942010 No primer for this exon
upstream ENSMUSE00000170616 Chr2:179941638..179941808 No primer for this exon
upstream ENSMUSE00000678444 Chr2:179941638..179941808 No primer for this exon
upstream ENSMUSE00000170586 Chr2:179941430..179941527 No primer for this exon
upstream ENSMUSE00000678443 Chr2:179941430..179941527 No primer for this exon

*** Putative Vector Insertion (Chr 2: 179937213 - 179941429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170623 Chr2:179937097..179937212 No primer for this exon
downstream ENSMUSE00000678442 Chr2:179937097..179937212 No primer for this exon
downstream ENSMUSE00000170595 Chr2:179936866..179936984 No primer for this exon
downstream ENSMUSE00000678441 Chr2:179936866..179936984 No primer for this exon
downstream ENSMUSE00000170570 Chr2:179936684..179936774 No primer for this exon
downstream ENSMUSE00000678440 Chr2:179936684..179936774 No primer for this exon
downstream ENSMUSE00000170596 Chr2:179936426..179936560 No primer for this exon
downstream ENSMUSE00000678439 Chr2:179936426..179936560 No primer for this exon
downstream ENSMUSE00000170634 Chr2:179936163..179936225 No primer for this exon
downstream ENSMUSE00000678438 Chr2:179936163..179936225 No primer for this exon
downstream ENSMUSE00000170620 Chr2:179933855..179933995 No primer for this exon
downstream ENSMUSE00000678437 Chr2:179933855..179933995 No primer for this exon
downstream ENSMUSE00000170589 Chr2:179933635..179933772 No primer for this exon
downstream ENSMUSE00000678436 Chr2:179933635..179933772 No primer for this exon
downstream ENSMUSE00000170566 Chr2:179933401..179933535 No primer for this exon
downstream ENSMUSE00000678435 Chr2:179933401..179933535 No primer for this exon
downstream ENSMUSE00000170593 Chr2:179933180..179933314 No primer for this exon
downstream ENSMUSE00000678434 Chr2:179933180..179933314 No primer for this exon
downstream ENSMUSE00000170590 Chr2:179932966..179933103 No primer for this exon
downstream ENSMUSE00000678433 Chr2:179932966..179933103 No primer for this exon
downstream ENSMUSE00000170619 Chr2:179932422..179932474 No primer for this exon
downstream ENSMUSE00000678432 Chr2:179932422..179932474 No primer for this exon
downstream ENSMUSE00000170568 Chr2:179932078..179932183 No primer for this exon
downstream ENSMUSE00000678431 Chr2:179932078..179932183 No primer for this exon
downstream ENSMUSE00000170571 Chr2:179931931..179931980 No primer for this exon
downstream ENSMUSE00000678430 Chr2:179931931..179931980 No primer for this exon
downstream ENSMUSE00000170602 Chr2:179931741..179931846 No primer for this exon
downstream ENSMUSE00000678429 Chr2:179931741..179931846 No primer for this exon
downstream ENSMUSE00000170588 Chr2:179931189..179931288 No primer for this exon
downstream ENSMUSE00000678428 Chr2:179931189..179931288 No primer for this exon
downstream ENSMUSE00000170584 Chr2:179930873..179931029 No primer for this exon
downstream ENSMUSE00000678426 Chr2:179930873..179931029 No primer for this exon
downstream ENSMUSE00000170607 Chr2:179930586..179930724 No primer for this exon
downstream ENSMUSE00000678425 Chr2:179930586..179930724 No primer for this exon
downstream ENSMUSE00000170574 Chr2:179930260..179930402 No primer for this exon
downstream ENSMUSE00000678423 Chr2:179930260..179930402 No primer for this exon
downstream ENSMUSE00000170599 Chr2:179930077..179930183 No primer for this exon
downstream ENSMUSE00000678421 Chr2:179930077..179930183 No primer for this exon
downstream ENSMUSE00000170601 Chr2:179929851..179930004 No primer for this exon
downstream ENSMUSE00000678419 Chr2:179929851..179930004 No primer for this exon
downstream ENSMUSE00000170576 Chr2:179929380..179929540 No primer for this exon
downstream ENSMUSE00000678417 Chr2:179929380..179929540 No primer for this exon
downstream ENSMUSE00000170626 Chr2:179929195..179929303 No primer for this exon
downstream ENSMUSE00000678415 Chr2:179929195..179929303 No primer for this exon
downstream ENSMUSE00000170622 Chr2:179928680..179928777 No primer for this exon
downstream ENSMUSE00000678414 Chr2:179928680..179928777 No primer for this exon
downstream ENSMUSE00000170624 Chr2:179928397..179928598 No primer for this exon
downstream ENSMUSE00000678413 Chr2:179928397..179928598 No primer for this exon
downstream ENSMUSE00000170621 Chr2:179928109..179928235 No primer for this exon
downstream ENSMUSE00000678412 Chr2:179928109..179928235 No primer for this exon
downstream ENSMUSE00000170611 Chr2:179927568..179927707 No primer for this exon
downstream ENSMUSE00000678410 Chr2:179927568..179927707 No primer for this exon
downstream ENSMUSE00000170578 Chr2:179927094..179927209 No primer for this exon
downstream ENSMUSE00000678409 Chr2:179927094..179927209 No primer for this exon
downstream ENSMUSE00000170615 Chr2:179926799..179927010 No primer for this exon
downstream ENSMUSE00000678407 Chr2:179926799..179927010 No primer for this exon
downstream ENSMUSE00000225872 Chr2:179926256..179926460 No primer for this exon
downstream ENSMUSE00000678406 Chr2:179926256..179926460 No primer for this exon
downstream ENSMUSE00000170629 Chr2:179925933..179926077 No primer for this exon
downstream ENSMUSE00000678404 Chr2:179925933..179926077 No primer for this exon
downstream ENSMUSE00000170627 Chr2:179925610..179925750 No primer for this exon
downstream ENSMUSE00000678403 Chr2:179925610..179925750 No primer for this exon
downstream ENSMUSE00000170618 Chr2:179925345..179925506 No primer for this exon
downstream ENSMUSE00000678402 Chr2:179925345..179925506 No primer for this exon
downstream ENSMUSE00000170637 Chr2:179925035..179925136 No primer for this exon
downstream ENSMUSE00000678401 Chr2:179925035..179925136 No primer for this exon
downstream ENSMUSE00000170598 Chr2:179924865..179924948 No primer for this exon
downstream ENSMUSE00000591578 Chr2:179924865..179924948 No primer for this exon
downstream ENSMUSE00000170635 Chr2:179924038..179924268 No primer for this exon
downstream ENSMUSE00000170617 Chr2:179923272..179923385 No primer for this exon
downstream ENSMUSE00000170594 Chr2:179922970..179923097 No primer for this exon
downstream ENSMUSE00000591577 Chr2:179922613..179922644 No primer for this exon
downstream ENSMUSE00000170585 Chr2:179922564..179922644 No primer for this exon
downstream ENSMUSE00000170632 Chr2:179922251..179922465 No primer for this exon
downstream ENSMUSE00000170636 Chr2:179921881..179921981 No primer for this exon
downstream ENSMUSE00000678400 Chr2:179921881..179921897 No primer for this exon
downstream ENSMUSE00000170638 Chr2:179921506..179921686 No primer for this exon
downstream ENSMUSE00000170610 Chr2:179921267..179921416 No primer for this exon
downstream ENSMUSE00000170582 Chr2:179920519..179920670 No primer for this exon
downstream ENSMUSE00000170606 Chr2:179920328..179920438 No primer for this exon
downstream ENSMUSE00000678399 Chr2:179920324..179920438 No primer for this exon
downstream ENSMUSE00000170580 Chr2:179920034..179920145 No primer for this exon
downstream ENSMUSE00000170569 Chr2:179919106..179919276 No primer for this exon
downstream ENSMUSE00000225769 Chr2:179918723..179918919 No primer for this exon
downstream ENSMUSE00000225760 Chr2:179918323..179918439 No primer for this exon
downstream ENSMUSE00000225754 Chr2:179918025..179918179 No primer for this exon
downstream ENSMUSE00000225747 Chr2:179917669..179917810 No primer for this exon
downstream ENSMUSE00000392335 Chr2:179917472..179917574 No primer for this exon
downstream ENSMUSE00000348555 Chr2:179917063..179917173 No primer for this exon
downstream ENSMUSE00000678398 Chr2:179917059..179917173 No primer for this exon
downstream ENSMUSE00000384695 Chr2:179916277..179916456 No primer for this exon
downstream ENSMUSE00000399794 Chr2:179916055..179916203 No primer for this exon
downstream ENSMUSE00000546393 Chr2:179916055..179916142 No primer for this exon
downstream ENSMUSE00000170613 Chr2:179915798..179915974 No primer for this exon
downstream ENSMUSE00000170583 Chr2:179915547..179915683 No primer for this exon
downstream ENSMUSE00000170572 Chr2:179915314..179915467 No primer for this exon
downstream ENSMUSE00000170592 Chr2:179915015..179915148 No primer for this exon
downstream ENSMUSE00000170579 Chr2:179914779..179914941 No primer for this exon
downstream ENSMUSE00000170575 Chr2:179914541..179914663 No primer for this exon
downstream ENSMUSE00000170581 Chr2:179914311..179914459 No primer for this exon
downstream ENSMUSE00000170625 Chr2:179913957..179914233 No primer for this exon
downstream ENSMUSE00000170639 Chr2:179913715..179913845 No primer for this exon
downstream ENSMUSE00000170608 Chr2:179913426..179913596 No primer for this exon
downstream ENSMUSE00000170604 Chr2:179913220..179913334 No primer for this exon
downstream ENSMUSE00000170597 Chr2:179912982..179913127 No primer for this exon
downstream ENSMUSE00000170631 Chr2:179912714..179912909 No primer for this exon
downstream ENSMUSE00000170567 Chr2:179912440..179912604 No primer for this exon
downstream ENSMUSE00000170591 Chr2:179912196..179912349 No primer for this exon
downstream ENSMUSE00000170628 Chr2:179911979..179912112 No primer for this exon
downstream ENSMUSE00000170630 Chr2:179911808..179911898 No primer for this exon
downstream ENSMUSE00000170612 Chr2:179911593..179911712 No primer for this exon
downstream ENSMUSE00000378411 Chr2:179911078..179911469 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACAT Chr2:179941359..179941380 61.86 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTGAGACCTGTGGCTCT Chr2:179941411..179941431 60.46 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015647