Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9142
Trapped Gene
Icam1 (ENSMUSG00000037405)
Vector Insertion
Chr 9: 20830303 - 20830755
Public Clones RST502 (baygenomics) G070B09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217299 (Chr9:20829988..20830302 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAAGTAGGCAAGGACCTCA Chr9:20830031..20830050 60.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217299 (Chr9:20829988..20830302 +)
Downstram Exon
ENSMUSE00000296932 (Chr9:20830756..20831043 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAAGTAGGCAAGGACCTCA Chr9:20830031..20830050 60.4 55 CTTTGGGATGGTAGCTGGAA Chr9:20830781..20830800 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000538786 Chr9:20820429..20820545 No primer for this exon
upstream ENSMUSE00000217308 Chr9:20823363..20823623 TGGTGATGCTCAGGTATCCA Chr9:20823367..20823386 60.07 50
upstream ENSMUSE00000217299 Chr9:20829988..20830302 GCAAGTAGGCAAGGACCTCA Chr9:20830031..20830050 60.4 55

*** Putative Vector Insertion (Chr 9: 20830303 - 20830755) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000296932 Chr9:20830756..20831043 CTTTGGGATGGTAGCTGGAA Chr9:20830781..20830800 60.07 50
downstream ENSMUSE00000296898 Chr9:20831522..20831779 GGCATTCAGTGTGAATTGGA Chr9:20831682..20831701 59.5 45
downstream ENSMUSE00000296800 Chr9:20831876..20832124 CTTCCGTCTGCAGGTCATCT Chr9:20832000..20832019 60.41 55
downstream ENSMUSE00000538773 Chr9:20832215..20833252 AGCTTGCACGACCCTTCTAA Chr9:20833187..20833206 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAGGAAGAAGACCCCTAA Chr9:20830337..20830357 59.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTCTTGGGAGGAAGAAG Chr9:20830329..20830349 60.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037405