Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9144
Trapped Gene
Gpc3 (ENSMUSG00000055653)
Vector Insertion
Chr X: 49626132 - 49668013
Public Clones RST505 (baygenomics) CMHD-GT_107B11-3 (cmhd) CMHD-GT_422D3-3 (cmhd) CMHD-GT_132E12-3 (cmhd)
(cmhd) CMHD-GT_384F9-3 (cmhd) IST15062D6 (tigm) IST15062D7 (tigm)
IST10933H2 (tigm) IST15062D7 (tigm)
Private Clones OST430990 (lexicon) OST361539 (lexicon) OST49604 (lexicon) OST49559 (lexicon)
OST44557 (lexicon) OST44549 (lexicon) OST43760 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436221 (ChrX:49668014..49668173 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCCCAAGGGTAAAGTTC ChrX:49668137..49668156 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436221 (ChrX:49668014..49668173 -)
Downstram Exon
ENSMUSE00000624027 (ChrX:49625610..49626131 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCCCAAGGGTAAAGTTC ChrX:49668137..49668156 59.97 50 AGGTGGTGATCTCGTTGTCC ChrX:49626029..49626048 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000520286 ChrX:49966810..49967127 TCTTGCTCTGTCGGGCTACT ChrX:49967062..49967081 60.16 55
upstream ENSMUSE00000719933 ChrX:49966810..49967127 TCTTGCTCTGTCGGGCTACT ChrX:49967062..49967081 60.16 55
upstream ENSMUSE00000436250 ChrX:49935974..49936135 TGCTCCAGTCTGCGAGTATG ChrX:49936017..49936036 60.16 55
upstream ENSMUSE00000436236 ChrX:49781617..49782311 TGCTCTTACTGCCAGGGACT ChrX:49781846..49781865 60.01 55
upstream ENSMUSE00000436230 ChrX:49750250..49750383 CCCAGCAACGCCAATATAGA ChrX:49750342..49750361 60.98 50
upstream ENSMUSE00000436226 ChrX:49741286..49741411 TGCTGGAACGGACAAGAACT ChrX:49741295..49741314 60.83 50
upstream ENSMUSE00000700805 ChrX:49740841..49741411 TGCTGGAACGGACAAGAACT ChrX:49741295..49741314 60.83 50
upstream ENSMUSE00000436223 ChrX:49718899..49719019 CGGTGGTTAGCCAGATCATT ChrX:49718923..49718942 59.96 50
upstream ENSMUSE00000436221 ChrX:49668014..49668173 TGTGCCCAAGGGTAAAGTTC ChrX:49668137..49668156 59.97 50

*** Putative Vector Insertion (Chr X: 49626132 - 49668013) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624027 ChrX:49625610..49626131 AGGTGGTGATCTCGTTGTCC ChrX:49626029..49626048 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCAGAGTTTTCCCACCAA ChrX:49637984..49638004 59.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCAGAGTTTTCCCACCAA ChrX:49637984..49638004 59.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGGGGTTATAATCGCCTTG ChrX:49638112..49638132 59.79 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTGCCCAAGGGTAAAGTTC ChrX:49638135..49638155 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055653