Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9146
Trapped Gene
Ldlr (ENSMUSG00000032193)
Vector Insertion
Chr 9: 21536879 - 21537934
Public Clones XST108 (baygenomics) XST128 (baygenomics) RST527 (baygenomics) KST285 (baygenomics)
Private Clones OST60703 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217568 (Chr9:21536756..21536878 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAATCAATTCAGCTGTGGA Chr9:21536774..21536793 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217568 (Chr9:21536756..21536878 +)
Downstram Exon
ENSMUSE00000217581 (Chr9:21537935..21538318 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAATCAATTCAGCTGTGGA Chr9:21536774..21536793 59.65 45 CCGTCAACACAGTCGACATC Chr9:21538151..21538170 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638289 Chr9:21528038..21528288 GCAACGCAGAAGCTAAGGAT Chr9:21528204..21528223 59.62 50
upstream ENSMUSE00000290216 Chr9:21536191..21536313 GCAGGAACGAGTTCCAGTGT Chr9:21536206..21536225 60.31 55
upstream ENSMUSE00000217568 Chr9:21536756..21536878 CCAATCAATTCAGCTGTGGA Chr9:21536774..21536793 59.65 45

*** Putative Vector Insertion (Chr 9: 21536879 - 21537934) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217581 Chr9:21537935..21538318 CCGTCAACACAGTCGACATC Chr9:21538151..21538170 60.16 55
downstream ENSMUSE00000217574 Chr9:21539681..21539803 GCAGTCATGTTCACGGTCAC Chr9:21539772..21539791 60.17 55
downstream ENSMUSE00000217585 Chr9:21541664..21541786 CTTGTCCAAGCTGATGCACT Chr9:21541731..21541750 59.04 50
downstream ENSMUSE00000217577 Chr9:21542318..21542437 ACAGGCACTCAGAGCCAATC Chr9:21542398..21542417 60.42 55
downstream ENSMUSE00000217586 Chr9:21543299..21543424 GGCTCCTGACACTCGTCAAT Chr9:21543323..21543342 60.27 55
downstream ENSMUSE00000217564 Chr9:21543830..21544001 ATTGTTGGTCACCTCCGTGT Chr9:21543963..21543982 60.28 50
downstream ENSMUSE00000217569 Chr9:21544093..21544317 CTCTTTACGCCCTTGGTGTC Chr9:21544257..21544276 59.73 55
downstream ENSMUSE00000217576 Chr9:21546631..21546749 GGATGTTTTCGGTCACCAGT Chr9:21546728..21546747 59.83 50
downstream ENSMUSE00000217583 Chr9:21547101..21547240 CCAAAATGGTTTTCCGATTG Chr9:21547196..21547215 60.16 40
downstream ENSMUSE00000217566 Chr9:21548366..21548507 GTGAGTCGATTGGCACTGAA Chr9:21548427..21548446 59.84 50
downstream ENSMUSE00000217588 Chr9:21548674..21548829 AGGTACTGGCAACCACCATT Chr9:21548731..21548750 59.33 50
downstream ENSMUSE00000217584 Chr9:21550176..21550349 GGGTGGTCAGTACAGTGTCG Chr9:21550202..21550221 59.02 60
downstream ENSMUSE00000217579 Chr9:21550806..21550883 ATACCATGTGGCTGCTCCTC Chr9:21550857..21550876 60.1 55
downstream ENSMUSE00000217571 Chr9:21551593..21551750 GCTCGTCCTCTGTGGTCTTC Chr9:21551712..21551731 59.99 60
downstream ENSMUSE00000351661 Chr9:21552585..21554360 CCAGGACCCGGTCAGTAGTA Chr9:21553043..21553062 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000032193