Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9147
Trapped Gene
Tmem2 (ENSMUSG00000024754)
Vector Insertion
Chr 19: 21882038 - 21883758
Public Clones RST399 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000642461 (Chr19:21881849..21882037 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGTTCTCAGGTCAAAGTC Chr19:21882014..21882033 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000642461 (Chr19:21881849..21882037 +)
Downstram Exon
ENSMUSE00000252348 (Chr19:21883759..21883928 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGTTCTCAGGTCAAAGTC Chr19:21882014..21882033 59.85 55 AATGTTGCGGGTGAGAAGTC Chr19:21883844..21883863 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000546673 Chr19:21852832..21853276 GCTGATTAGAGGGACCCTAGC Chr19:21852870..21852890 59.34 57.14
upstream ENSMUSE00000620765 Chr19:21854661..21854742 GAGAACTCTGAGCCGTCACC Chr19:21854682..21854701 59.99 60
upstream ENSMUSE00000642465 Chr19:21867128..21867470 ATCTGCTTCGCCATAACCAG Chr19:21867389..21867408 60.24 50
upstream ENSMUSE00000642464 Chr19:21871817..21871957 CAAAACCCTCGTCTCAGGAA Chr19:21871831..21871850 60.22 50
upstream ENSMUSE00000642463 Chr19:21872357..21872918 GGCAAGTCAGATGAACGTGA Chr19:21872500..21872519 59.84 50
upstream ENSMUSE00000642462 Chr19:21876352..21876521 TGGGCCTTAGTTGGTGTCAT Chr19:21876359..21876378 60.38 50
upstream ENSMUSE00000642461 Chr19:21881849..21882037 GCCGTTCTCAGGTCAAAGTC Chr19:21882014..21882033 59.85 55

*** Putative Vector Insertion (Chr 19: 21882038 - 21883758) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252348 Chr19:21883759..21883928 AATGTTGCGGGTGAGAAGTC Chr19:21883844..21883863 60.12 50
downstream ENSMUSE00000252328 Chr19:21886257..21886466 GATGAACAGACAGGCCATCC Chr19:21886422..21886441 60.48 55
downstream ENSMUSE00000353366 Chr19:21886701..21886906 AGTGTGTCGAAGCCAATGGT Chr19:21886732..21886751 60.58 50
downstream ENSMUSE00000252251 Chr19:21887041..21887110 CAGCTGCGTTATTGATCAGG Chr19:21887102..21887121 59.44 50
downstream ENSMUSE00000252233 Chr19:21889921..21890049 ACTGGACTCCCCAGTTGGTT Chr19:21889974..21889993 60.8 55
downstream ENSMUSE00000252215 Chr19:21892413..21892501 TGGTCGTTTTGACACCTTTG Chr19:21892452..21892471 59.58 45
downstream ENSMUSE00000252195 Chr19:21898278..21898409 CAATGAGCCTGTCGATGATG Chr19:21898348..21898367 60.22 50
downstream ENSMUSE00000252178 Chr19:21899580..21899615 GTCAGCCCCTTTCCGTTATC Chr19:21899609..21899628 60.83 55
downstream ENSMUSE00000252158 Chr19:21900530..21900685 TCCTGACTGGACCCTTCATC Chr19:21900571..21900590 60.05 55
downstream ENSMUSE00000252137 Chr19:21904290..21904467 AGGCCCATCGTAAATCTGAA Chr19:21904332..21904351 59.53 45
downstream ENSMUSE00000252113 Chr19:21906517..21906732 GAGTTCTTATCGCCGTCCAG Chr19:21906593..21906612 59.84 55
downstream ENSMUSE00000252086 Chr19:21909908..21910116 CAACAGGCTGGTACTGTGGA Chr19:21910037..21910056 59.74 55
downstream ENSMUSE00000144752 Chr19:21916531..21916713 AACCTGAAAGCTCGTGTTGG Chr19:21916588..21916607 60.29 50
downstream ENSMUSE00000144754 Chr19:21919110..21919329 AATACTGCGGGTACGCTTTG Chr19:21919258..21919277 60.15 50
downstream ENSMUSE00000144757 Chr19:21922427..21922525 TCCTCGCTGAATTTCTGCTT Chr19:21922510..21922529 60.1 45
downstream ENSMUSE00000144755 Chr19:21926715..21926869 GAACATCCGCTTTTCCTTCA Chr19:21926816..21926835 60.19 45
downstream ENSMUSE00000144758 Chr19:21930149..21930252 GCCAGTCCCAGAACTGCTAA Chr19:21930229..21930248 60.4 55
downstream ENSMUSE00000546624 Chr19:21930645..21932817 CGCTCTGCGTTTTAAAGGTC Chr19:21931587..21931606 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGGAAACACGCTTTTCTT Chr19:21882060..21882080 59.72 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCTTGGCATCTGTCGTG Chr19:21882073..21882093 59.84 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024754