Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9149
Trapped Gene
Igf2r (ENSMUSG00000023830)
Vector Insertion
Chr 17: 12881370 - 12881855
Public Clones RST408 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000135655 (Chr17:12881856..12882002 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTCGGCGAGATTTATTT Chr17:12881859..12881878 60.19 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000135655 (Chr17:12881856..12882002 -)
Downstram Exon
ENSMUSE00000135677 (Chr17:12881182..12881369 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTCGGCGAGATTTATTT Chr17:12881859..12881878 60.19 45 GCATGCAGGGTAAGAAGAGC Chr17:12881251..12881270 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402412 Chr17:12962266..12962530 CCTGGCTCCAGTTCTCTCTC Chr17:12962510..12962529 59.13 60
upstream ENSMUSE00000416277 Chr17:12941510..12941649 CAACGTCTGTGGAAATGTGG Chr17:12941582..12941601 60 50
upstream ENSMUSE00000468080 Chr17:12933148..12933272 CAGCCTTCAGATTCACAGCA Chr17:12933191..12933210 60.14 50
upstream ENSMUSE00000135694 Chr17:12932153..12932251 GCAGCCTGCAAGAAAGACATA Chr17:12932171..12932191 60.54 47.62
upstream ENSMUSE00000135700 Chr17:12928833..12928965 ACCATGCTATGCATTTGATGAC Chr17:12928942..12928963 59.86 40.91
upstream ENSMUSE00000135665 Chr17:12926663..12926792 CTGAAGCTGTTGAGCAAGGA Chr17:12926666..12926685 59.31 50
upstream ENSMUSE00000135675 Chr17:12924274..12924379 CAGCCCTGCAGTGACAGTAA Chr17:12924303..12924322 60.05 55
upstream ENSMUSE00000135698 Chr17:12919537..12919699 CCAAGTCCAACTGCCGTTAT Chr17:12919658..12919677 59.99 50
upstream ENSMUSE00000135676 Chr17:12919056..12919221 AGAAAAAGGCGGATTCCACT Chr17:12919097..12919116 60.07 45
upstream ENSMUSE00000135669 Chr17:12918181..12918284 TGGAGACCTCACCCTCATCT Chr17:12918256..12918275 59.64 55
upstream ENSMUSE00000135691 Chr17:12914994..12915158 TCTGTGTTGGCTCGTCACTC Chr17:12914996..12915015 60.03 55
upstream ENSMUSE00000135674 Chr17:12912679..12912816 AGCCAGGCAGAATCAGAAAA Chr17:12912765..12912784 59.96 45
upstream ENSMUSE00000135679 Chr17:12911518..12911661 No primer for this exon
upstream ENSMUSE00000245802 Chr17:12910139..12910276 AGAACTGCACGGTCCTTGAT Chr17:12910149..12910168 59.73 50
upstream ENSMUSE00000135672 Chr17:12909435..12909582 GTTTGTGGCCCTGTATCCAT Chr17:12909480..12909499 59.68 50
upstream ENSMUSE00000135704 Chr17:12908739..12908913 GAGCTACAGGAACGGCACTC Chr17:12908828..12908847 60.02 60
upstream ENSMUSE00000135685 Chr17:12908244..12908359 CTTCCGGTGGTACACCAGTT Chr17:12908317..12908336 59.88 55
upstream ENSMUSE00000135682 Chr17:12907739..12907907 ATGTGTGTCGGCCTCTGAAT Chr17:12907799..12907818 60.54 50
upstream ENSMUSE00000135681 Chr17:12906827..12907006 TATGTGAACGGCTCTGCTTG Chr17:12906897..12906916 60.01 50
upstream ENSMUSE00000135703 Chr17:12904885..12904986 CCTGCCCTATCCAGACAATC Chr17:12904900..12904919 59.51 55
upstream ENSMUSE00000135660 Chr17:12903503..12903607 CCACTCAACGATTCTGCTCA Chr17:12903540..12903559 59.98 50
upstream ENSMUSE00000135688 Chr17:12902245..12902440 CGAGGCCGAAACTCAGATAG Chr17:12902359..12902378 59.97 55
upstream ENSMUSE00000245636 Chr17:12898554..12898718 CAGGACATTGACTCCACACG Chr17:12898631..12898650 60.15 55
upstream ENSMUSE00000245617 Chr17:12897763..12897906 GTCTGCATACGGGAAGAGGA Chr17:12897817..12897836 60.22 55
upstream ENSMUSE00000135709 Chr17:12897499..12897674 TGTGGTGCAGATCAGTCCTC Chr17:12897603..12897622 59.83 55
upstream ENSMUSE00000135663 Chr17:12897138..12897225 CCAGTTCGTGAACAACTGTGA Chr17:12897191..12897211 59.78 47.62
upstream ENSMUSE00000135656 Chr17:12896227..12896442 CCTACTACTTGCGGGTCTGC Chr17:12896327..12896346 59.9 60
upstream ENSMUSE00000135684 Chr17:12895063..12895193 GGGGATACCTGCCATAAGGT Chr17:12895115..12895134 60.04 55
upstream ENSMUSE00000245461 Chr17:12894799..12894896 ATGTTTGAGTGGCGAACACA Chr17:12894841..12894860 60.16 45
upstream ENSMUSE00000245427 Chr17:12894086..12894222 AGTGACAACTGGGAGGCTGT Chr17:12894157..12894176 59.76 55
upstream ENSMUSE00000135707 Chr17:12893208..12893398 CCCAGACAAAATTCGGAGAA Chr17:12893249..12893268 60.04 45
upstream ENSMUSE00000135708 Chr17:12892046..12892172 GATGACTGCCAAGTCACCAA Chr17:12892057..12892076 59.68 50
upstream ENSMUSE00000135705 Chr17:12891391..12891510 AATGCCTCCTACAGCGAGAA Chr17:12891447..12891466 59.98 50
upstream ENSMUSE00000135651 Chr17:12890952..12891208 TCCTGCAGCTGGTGTATGAG Chr17:12891120..12891139 60.01 55
upstream ENSMUSE00000135668 Chr17:12890191..12890409 TGTACTGTGCGGAATGGAAG Chr17:12890384..12890403 59.72 50
upstream ENSMUSE00000135689 Chr17:12888152..12888301 CACTCATTGCTTAGCCGACA Chr17:12888208..12888227 60.01 50
upstream ENSMUSE00000135706 Chr17:12886869..12887030 GGACCAATGACTGCGACTTT Chr17:12886992..12887011 60.12 50
upstream ENSMUSE00000135671 Chr17:12885940..12886147 GCACCAAGATGAAGCAGTCA Chr17:12885976..12885995 59.99 50
upstream ENSMUSE00000135667 Chr17:12885505..12885651 GCGAAACTGTGGTGTAGCAA Chr17:12885552..12885571 59.91 50
upstream ENSMUSE00000135673 Chr17:12884749..12884983 GAAGATCGTGGGTGTGAGGT Chr17:12884887..12884906 59.97 55
upstream ENSMUSE00000135678 Chr17:12884023..12884159 TACAAAGGTCCCCTGGACTG Chr17:12884112..12884131 59.96 55
upstream ENSMUSE00000135657 Chr17:12882998..12883112 TTGACCTGTGCGAAGACTGT Chr17:12883019..12883038 59.47 50
upstream ENSMUSE00000135655 Chr17:12881856..12882002 AGCCTCGGCGAGATTTATTT Chr17:12881859..12881878 60.19 45

*** Putative Vector Insertion (Chr 17: 12881370 - 12881855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135677 Chr17:12881182..12881369 GCATGCAGGGTAAGAAGAGC Chr17:12881251..12881270 59.99 55
downstream ENSMUSE00000135687 Chr17:12879488..12879674 GATCCCATCCTTCACCAGAG Chr17:12879540..12879559 59.46 55
downstream ENSMUSE00000135699 Chr17:12878457..12878600 CGCTCTCATCCTCAAAGTCC Chr17:12878556..12878575 59.95 55
downstream ENSMUSE00000135666 Chr17:12878004..12878073 GCAGCTGGTCAGCTTGTTTA Chr17:12878021..12878040 59.22 50
downstream ENSMUSE00000371471 Chr17:12875279..12876992 GGCACCACGGAGTTAGATGT Chr17:12876542..12876561 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTCGGCGAGATTTATTTT Chr17:12881856..12881876 60.54 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTCGGCGAGATTTATTTT Chr17:12881856..12881876 60.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023830