Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9171
Trapped Gene
AL833803.8 (ENSMUSG00000082079)
Vector Insertion
Chr 2: 153546240 - 153549217
Public Clones RRE122 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711881 (Chr2:153546091..153546239 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGAGGTCGGTGACAAGAG Chr2:153546198..153546217 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711881 (Chr2:153546091..153546239 +)
Downstram Exon
ENSMUSE00000714107 (Chr2:153549218..153549303 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGAGGTCGGTGACAAGAG Chr2:153546198..153546217 60.11 55 GTGAGCAGCAGACACCTTGA Chr2:153549265..153549284 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720866 Chr2:153522388..153522544 GGACCTGCAGTGACCAGTCT Chr2:153522461..153522480 60.31 60
upstream ENSMUSE00000714173 Chr2:153523378..153523439 TGCAGAACAAGCTCACAACC Chr2:153523380..153523399 60.03 50
upstream ENSMUSE00000719694 Chr2:153531103..153531219 GCCCCAACTCTTCTGTGAGA Chr2:153531177..153531196 60.39 55
upstream ENSMUSE00000714701 Chr2:153532120..153532329 AGTACCCCATCGGTTGACTG Chr2:153532228..153532247 59.84 55
upstream ENSMUSE00000709801 Chr2:153537420..153537515 TCTCGGCTGACAAACTGTTG Chr2:153537421..153537440 60.03 50
upstream ENSMUSE00000715770 Chr2:153539216..153539360 GGAGAGTCACTGGAGGACCA Chr2:153539258..153539277 60.24 60
upstream ENSMUSE00000716491 Chr2:153540691..153540810 AAAGTCGAAGACGCACAACC Chr2:153540697..153540716 60.3 50
upstream ENSMUSE00000709726 Chr2:153540971..153541015 ACAACAAGGGCAATCTGGAA Chr2:153540995..153541014 60.49 45
upstream ENSMUSE00000721136 Chr2:153542220..153542299 CACTGTTTGTCGTGCGGTAG Chr2:153542222..153542241 60.36 55
upstream ENSMUSE00000714356 Chr2:153542582..153542694 ATGACGAGGACGGCTATCAG Chr2:153542610..153542629 60.24 55
upstream ENSMUSE00000715394 Chr2:153543085..153543271 GTGGAGTGTCTGGAGGTGCT Chr2:153543095..153543114 60.31 60
upstream ENSMUSE00000721643 Chr2:153543958..153544042 AAGGAGGCCCATTAGAGTCC Chr2:153543996..153544015 59.54 55
upstream ENSMUSE00000719826 Chr2:153544941..153545086 GGTGCTCAAGGAGTTGGGTA Chr2:153544948..153544967 60.11 55
upstream ENSMUSE00000716590 Chr2:153545681..153545771 GACCTGGTGATTGGTGGAAG Chr2:153545702..153545721 60.36 55
upstream ENSMUSE00000711881 Chr2:153546091..153546239 ATGGAGGTCGGTGACAAGAG Chr2:153546198..153546217 60.11 55

*** Putative Vector Insertion (Chr 2: 153546240 - 153549217) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000714107 Chr2:153549218..153549303 GTGAGCAGCAGACACCTTGA Chr2:153549265..153549284 60.19 55
downstream ENSMUSE00000708502 Chr2:153552212..153552281 ACTGAACTCCAGGCAGTCCT Chr2:153552272..153552291 58.9 55
downstream ENSMUSE00000717137 Chr2:153552963..153553081 TGATGGAGTTCGACTTGGTG Chr2:153553008..153553027 59.68 50
downstream ENSMUSE00000713084 Chr2:153555502..153555641 TGTTCAGGAAAGCCGAAGAT Chr2:153555525..153555544 59.81 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGATTCCTGGAGGTGAGTG Chr2:153549228..153549248 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTCTTCCTGCAGCGTGACT Chr2:153549205..153549226 62.01 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000082079