Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9212
Trapped Gene
Akap10 (ENSMUSG00000047804)
Vector Insertion
Chr 11: 61691529 - 61700201
Public Clones RRC139 (baygenomics)
Private Clones OST321840 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359233 (Chr11:61700202..61700284 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGCCTGAACCTGATGTGA Chr11:61700214..61700233 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359233 (Chr11:61700202..61700284 -)
Downstram Exon
ENSMUSE00000404737 (Chr11:61691476..61691528 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGCCTGAACCTGATGTGA Chr11:61700214..61700233 60.4 50 CCTTGCACCCACTTCTTCAT Chr11:61691467..61691486 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662191 Chr11:61743491..61743728 AAGGGGCTGTTTTCGGACTA Chr11:61743623..61743642 60.98 50
upstream ENSMUSE00000717396 Chr11:61743491..61743728 AAGGGGCTGTTTTCGGACTA Chr11:61743623..61743642 60.98 50
upstream ENSMUSE00000431729 Chr11:61736284..61736331 No primer for this exon
upstream ENSMUSE00000431724 Chr11:61729586..61729768 ACCAAGTCATGTTGCGATCA Chr11:61729685..61729704 60.12 45
upstream ENSMUSE00000677738 Chr11:61729586..61729720 ACCAAGTCATGTTGCGATCA Chr11:61729685..61729704 60.12 45
upstream ENSMUSE00000345045 Chr11:61728526..61729083 AGCACCTGGTGAAATTTTGG Chr11:61728938..61728957 59.97 45
upstream ENSMUSE00000353594 Chr11:61723350..61723448 CCAGATGCTGCTAAGCCAAT Chr11:61723385..61723404 60.37 50
upstream ENSMUSE00000399914 Chr11:61718277..61718361 GTGGATCCCAACTGTTTCGT Chr11:61718316..61718335 59.83 50
upstream ENSMUSE00000388091 Chr11:61717409..61717532 CCAGATTGAAGTGCTGACCA Chr11:61717471..61717490 59.83 50
upstream ENSMUSE00000413489 Chr11:61713812..61713948 GCAGCGGATAATTTCCAGTC Chr11:61713884..61713903 59.67 50
upstream ENSMUSE00000399981 Chr11:61710150..61710294 CCTGGACAACCATGGAGAAG Chr11:61710150..61710169 60.5 55
upstream ENSMUSE00000387852 Chr11:61706882..61707055 TTTTGCCTGGTTTTCTGTCC Chr11:61707032..61707051 60.09 45
upstream ENSMUSE00000677736 Chr11:61705279..61707055 TGTCTGCCTTCCTGAGGAGT Chr11:61706917..61706936 59.99 55
upstream ENSMUSE00000349923 Chr11:61703740..61703849 TTGTGGATGCTGCAAGTCTG Chr11:61703775..61703794 61.02 50
upstream ENSMUSE00000677737 Chr11:61703292..61703849 GGCATTGTGGCCTACCTTTA Chr11:61703612..61703631 59.96 50
upstream ENSMUSE00000359233 Chr11:61700202..61700284 TGAGCCTGAACCTGATGTGA Chr11:61700214..61700233 60.4 50

*** Putative Vector Insertion (Chr 11: 61691529 - 61700201) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000404737 Chr11:61691476..61691528 CCTTGCACCCACTTCTTCAT Chr11:61691467..61691486 60.11 50
downstream ENSMUSE00000662190 Chr11:61690809..61690904 AGTGGTTGATCATGGTGTGC Chr11:61690803..61690822 59.4 50
downstream ENSMUSE00000662189 Chr11:61684809..61686523 GATAGCGGAATGGGTCTTGA Chr11:61685844..61685863 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGAGTCTGAGCCTGAACC Chr11:61700220..61700240 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGAGTCTGAGCCTGAACC Chr11:61700220..61700240 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047804