Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9286
Trapped Gene
Vprbp (ENSMUSG00000040325)
Vector Insertion
Chr 9: 106733188 - 106733266
Public Clones XH020 (baygenomics) A041D01 (ggtc) W163B02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000530240 (Chr9:106733189..106733265 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000530240 (Chr9:106733189..106733265 +)
Downstram Exon
ENSMUSE00000691755 (Chr9:106733189..106733265 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGGATGTCGATCATCAAATGG Chr9:106733266..106733286 59.76 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459037 Chr9:106724307..106724422 GACCAGAGGCAGTGTGTGAG Chr9:106724350..106724369 59.44 60
upstream ENSMUSE00000710134 Chr9:106731392..106731509 AGCTCACTACCCTGCTGGAG Chr9:106731437..106731456 59.62 60
upstream ENSMUSE00000718309 Chr9:106731392..106731509 AGCTCACTACCCTGCTGGAG Chr9:106731437..106731456 59.62 60

*** Putative Vector Insertion (Chr 9: 106733188 - 106733266) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000530240 Chr9:106733189..106733265 AGGATGTCGATCATCAAATGG Chr9:106733266..106733286 59.76 42.86
downstream ENSMUSE00000691755 Chr9:106733189..106733265 AGGATGTCGATCATCAAATGG Chr9:106733266..106733286 59.76 42.86
downstream ENSMUSE00000530239 Chr9:106736480..106736553 AAATGGCCCAGCATACACTC Chr9:106736516..106736535 59.96 50
downstream ENSMUSE00000691754 Chr9:106736480..106736553 AAATGGCCCAGCATACACTC Chr9:106736516..106736535 59.96 50
downstream ENSMUSE00000530237 Chr9:106737847..106737960 GACAACTGCGGTTTCTAGGC Chr9:106737951..106737970 59.88 55
downstream ENSMUSE00000691753 Chr9:106737847..106737960 GACAACTGCGGTTTCTAGGC Chr9:106737951..106737970 59.88 55
downstream ENSMUSE00000530236 Chr9:106738892..106739029 CCTCCCAGCAGTCCAGTAGA Chr9:106738977..106738996 60.4 60
downstream ENSMUSE00000691752 Chr9:106738892..106739029 CCTCCCAGCAGTCCAGTAGA Chr9:106738977..106738996 60.4 60
downstream ENSMUSE00000530235 Chr9:106740530..106741039 CCACTGCCATGTCACCATAG Chr9:106740689..106740708 59.98 55
downstream ENSMUSE00000691751 Chr9:106740530..106741039 CCACTGCCATGTCACCATAG Chr9:106740689..106740708 59.98 55
downstream ENSMUSE00000530234 Chr9:106741363..106741464 AGCAGGACATCATTCGTCTG Chr9:106741448..106741467 58.83 50
downstream ENSMUSE00000691750 Chr9:106741363..106741464 AGCAGGACATCATTCGTCTG Chr9:106741448..106741467 58.83 50
downstream ENSMUSE00000530233 Chr9:106746467..106746625 CACCAGTTGCAGCCATAGAA Chr9:106746578..106746597 59.86 50
downstream ENSMUSE00000691749 Chr9:106746467..106746625 CACCAGTTGCAGCCATAGAA Chr9:106746578..106746597 59.86 50
downstream ENSMUSE00000530232 Chr9:106748990..106749169 ACCAGACGACGAAGACCATC Chr9:106749165..106749184 60.12 55
downstream ENSMUSE00000691748 Chr9:106748990..106749169 ACCAGACGACGAAGACCATC Chr9:106749165..106749184 60.12 55
downstream ENSMUSE00000530231 Chr9:106750112..106750321 GCTGGGGGTGAACAAGAATA Chr9:106750313..106750332 59.93 50
downstream ENSMUSE00000691745 Chr9:106750112..106750321 GCTGGGGGTGAACAAGAATA Chr9:106750313..106750332 59.93 50
downstream ENSMUSE00000530230 Chr9:106754269..106754438 AATTGCAGGCGATGGAAATA Chr9:106754422..106754441 60.42 40
downstream ENSMUSE00000691744 Chr9:106754269..106754438 AATTGCAGGCGATGGAAATA Chr9:106754422..106754441 60.42 40
downstream ENSMUSE00000530229 Chr9:106756501..106756625 CCAAAGCAAAACGCACAGTA Chr9:106756529..106756548 59.91 45
downstream ENSMUSE00000634495 Chr9:106756501..106756625 CCAAAGCAAAACGCACAGTA Chr9:106756529..106756548 59.91 45
downstream ENSMUSE00000530228 Chr9:106760155..106761418 CAGTCGTGCGAGAGACACAT Chr9:106760681..106760700 60.06 55
downstream ENSMUSE00000634494 Chr9:106760155..106761038 CAGTCGTGCGAGAGACACAT Chr9:106760681..106760700 60.06 55
downstream ENSMUSE00000691742 Chr9:106760155..106761418 CAGTCGTGCGAGAGACACAT Chr9:106760681..106760700 60.06 55
downstream ENSMUSE00000530227 Chr9:106761912..106762110 TTCCCGGAATACTGAAATCG Chr9:106761942..106761961 59.89 45
downstream ENSMUSE00000691741 Chr9:106761912..106762110 TTCCCGGAATACTGAAATCG Chr9:106761942..106761961 59.89 45
downstream ENSMUSE00000530226 Chr9:106762710..106762792 CCAAGTGGCAGATGTCAGAA Chr9:106762745..106762764 59.83 50
downstream ENSMUSE00000691740 Chr9:106762710..106762792 CCAAGTGGCAGATGTCAGAA Chr9:106762745..106762764 59.83 50
downstream ENSMUSE00000530225 Chr9:106763299..106763383 CCTATGACCCGATCCTGAGA Chr9:106763364..106763383 60.03 55
downstream ENSMUSE00000691739 Chr9:106763299..106763383 CCTATGACCCGATCCTGAGA Chr9:106763364..106763383 60.03 55
downstream ENSMUSE00000530224 Chr9:106765348..106765581 TCAACAGCTTGTTGCCAGTC Chr9:106765384..106765403 60.03 50
downstream ENSMUSE00000583327 Chr9:106765348..106765581 TCAACAGCTTGTTGCCAGTC Chr9:106765384..106765403 60.03 50
downstream ENSMUSE00000583330 Chr9:106765981..106766074 CATCACTGTCCCAGTGTGGT Chr9:106766070..106766089 59.41 55
downstream ENSMUSE00000583329 Chr9:106766847..106766951 TCATCATCTGCCTGCAACAT Chr9:106766871..106766890 60.23 45
downstream ENSMUSE00000530200 Chr9:106767344..106767435 No primer for this exon
downstream ENSMUSE00000530222 Chr9:106767362..106767435 No primer for this exon
downstream ENSMUSE00000583328 Chr9:106767929..106768030 No primer for this exon
downstream ENSMUSE00000458724 Chr9:106776387..106776639 TCAGCTCCACCTCCTCATCT Chr9:106776630..106776649 59.94 55
downstream ENSMUSE00000409364 Chr9:106782265..106782758 GGGCCTAGTCCCTGTAGCTC Chr9:106782620..106782639 60.23 65
downstream ENSMUSE00000527242 Chr9:106782265..106782758 GGGCCTAGTCCCTGTAGCTC Chr9:106782620..106782639 60.23 65
downstream ENSMUSE00000634492 Chr9:106782634..106782714 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA Chr9:106733237..106733257 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGATCGTGACTGGGAAAA Chr9:106733233..106733253 60.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040325