Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9293
Trapped Gene
Rbm16 (ENSMUSG00000046201)
Vector Insertion
Chr 17: 3193083 - 3195777
Public Clones XH057 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000445485 (Chr17:3193014..3193082 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCACCGGTAGTACCAACAT Chr17:3193063..3193082 59.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000445485 (Chr17:3193014..3193082 +)
Downstram Exon
ENSMUSE00000280452 (Chr17:3195778..3195993 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCACCGGTAGTACCAACAT Chr17:3193063..3193082 59.59 55 GTCATGGACAATGGTGGTTG Chr17:3195808..3195827 59.66 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658492 Chr17:3114967..3115418 GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60
upstream ENSMUSE00000658491 Chr17:3114979..3115418 GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60
upstream ENSMUSE00000367004 Chr17:3145075..3145158 AAAGGCAGCCATCAAAGCTA Chr17:3145134..3145153 59.98 45
upstream ENSMUSE00000468506 Chr17:3148536..3148580 No primer for this exon
upstream ENSMUSE00000547043 Chr17:3150785..3150943 CATGTGGTTGCTGGAATTTG Chr17:3150880..3150899 59.96 45
upstream ENSMUSE00000379333 Chr17:3159163..3159324 GGCATCAGTTTGGTCAAGAAA Chr17:3159224..3159244 60.1 42.86
upstream ENSMUSE00000345755 Chr17:3162959..3163112 CAGTTGTCACGCCTGTTTTG Chr17:3163059..3163078 60.34 50
upstream ENSMUSE00000392504 Chr17:3164147..3164277 TGGTCCAAGGCTTACCTGAT Chr17:3164180..3164199 59.55 50
upstream ENSMUSE00000348840 Chr17:3167963..3168139 ACACTTACGCCCTTGGATCA Chr17:3168101..3168120 60.52 50
upstream ENSMUSE00000333169 Chr17:3169327..3169406 TTTGGGGAAGATTCTGAGCA Chr17:3169348..3169367 60.71 45
upstream ENSMUSE00000445526 Chr17:3171103..3171220 GCAGCAGAACTTGGAGCAGT Chr17:3171163..3171182 60.74 55
upstream ENSMUSE00000367371 Chr17:3177093..3177224 GATAGCCAGGAGGGGACATT Chr17:3177105..3177124 60.29 55
upstream ENSMUSE00000280233 Chr17:3177611..3177723 TGAAGGGCAAGATGTTGTTG Chr17:3177625..3177644 59.69 45
upstream ENSMUSE00000280209 Chr17:3178155..3178348 GAAAGCGAAAGCACAGGAAG Chr17:3178196..3178215 60.13 50
upstream ENSMUSE00000280184 Chr17:3185064..3185164 GCAGCACTACTCTCTGGGTTG Chr17:3185067..3185087 60.07 57.14
upstream ENSMUSE00000235905 Chr17:3185761..3185874 CATTTCGGGCTCTTCAGAAA Chr17:3185813..3185832 60.32 45
upstream ENSMUSE00000280138 Chr17:3187589..3187745 GTGGATCTTGGCGTCACATA Chr17:3187643..3187662 59.53 50
upstream ENSMUSE00000403192 Chr17:3190147..3190280 CAGAGGTTTTCCCTCCTCCT Chr17:3190246..3190265 59.67 55
upstream ENSMUSE00000280487 Chr17:3191817..3191961 TTAGTTCCTCCAGCGTTTCC Chr17:3191850..3191869 59.31 50
upstream ENSMUSE00000445485 Chr17:3193014..3193082 CCCACCGGTAGTACCAACAT Chr17:3193063..3193082 59.59 55

*** Putative Vector Insertion (Chr 17: 3193083 - 3195777) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000280452 Chr17:3195778..3195993 GTCATGGACAATGGTGGTTG Chr17:3195808..3195827 59.66 50
downstream ENSMUSE00000400161 Chr17:3196760..3198855 GTAAGCCTTTTGGACCACCA Chr17:3197746..3197765 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:3193133..3193153 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATCCCACCGGTAGTACCAA Chr17:3193061..3193081 59.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046201