Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9296
Trapped Gene
Abcf2 (ENSMUSG00000028953)
Vector Insertion
Chr 5: 24080198 - 24082336
Public Clones XH063 (baygenomics) PST0084-NR (escells) PST12133-NR (escells) PST11538-NR (escells)
PST84-1 (escells)
Private Clones OST450236 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000183779 (Chr5:24082337..24082545 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAAATCGAGGAGGCCAAT Chr5:24082362..24082381 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000183779 (Chr5:24082337..24082545 -)
Downstram Exon
ENSMUSE00000183773 (Chr5:24079985..24080197 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAAATCGAGGAGGCCAAT Chr5:24082362..24082381 60.04 45 CTCGAGCAGCAGCTTTCTTC Chr5:24080116..24080135 60.56 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655342 Chr5:24083165..24083217 No primer for this exon
upstream ENSMUSE00000183779 Chr5:24082337..24082545 AGAAAATCGAGGAGGCCAAT Chr5:24082362..24082381 60.04 45

*** Putative Vector Insertion (Chr 5: 24080198 - 24082336) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000183773 Chr5:24079985..24080197 CTCGAGCAGCAGCTTTCTTC Chr5:24080116..24080135 60.56 55
downstream ENSMUSE00000183767 Chr5:24079240..24079594 CTTCCAGCCGTTCATAGAGC Chr5:24079348..24079367 59.98 55
downstream ENSMUSE00000183777 Chr5:24077821..24077916 CATGAAGGGCCGAATAAAGA Chr5:24077870..24077889 60.03 45
downstream ENSMUSE00000183761 Chr5:24076962..24077064 GGTACAGACCCCATTCAGGA Chr5:24076982..24077001 59.78 55
downstream ENSMUSE00000183765 Chr5:24074889..24074984 TCCAGCCGTGTCTTCACATA Chr5:24074928..24074947 60.26 50
downstream ENSMUSE00000183769 Chr5:24074556..24074675 CACAACCCTTTCTGTCAGTCC Chr5:24074543..24074563 59.61 52.38
downstream ENSMUSE00000183763 Chr5:24074385..24074474 GCTCACGTTCTGCACCATAA Chr5:24074384..24074403 59.87 50
downstream ENSMUSE00000183760 Chr5:24074023..24074133 GAGCCACTCGTGTGTCAAGA Chr5:24074057..24074076 60.03 55
downstream ENSMUSE00000261214 Chr5:24073319..24073381 CTTCCGGATCATTCCATCTG Chr5:24073330..24073349 60.42 50
downstream ENSMUSE00000261206 Chr5:24073002..24073130 CCAATGGTGAAAGGTCAAGG Chr5:24073069..24073088 60.35 50
downstream ENSMUSE00000183771 Chr5:24072297..24072500 GGTCTCGATGTCCAGGTGAT Chr5:24072356..24072375 59.93 55
downstream ENSMUSE00000183775 Chr5:24071161..24071821 ACCCAAATCTCCTGTGCAAC Chr5:24071780..24071799 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTCCTGAGCTGGTTTTCG Chr5:24082302..24082322 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTCCTGAGCTGGTTTTCG Chr5:24082302..24082322 59.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTACCCCTGTGGCTCATCA Chr5:24082506..24082526 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTACCCCTGTGGCTCATCA Chr5:24082506..24082526 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028953