Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9307
Trapped Gene
2210018M11Rik (ENSMUSG00000035401)
Vector Insertion
Chr 7: 105759376 - 105761493
Public Clones XH265 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000529351 (Chr7:105761494..105761667 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTACAAGACCCATCACCA Chr7:105761595..105761614 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000529351 (Chr7:105761494..105761667 -)
Downstram Exon
ENSMUSE00000529349 (Chr7:105759177..105759375 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTACAAGACCCATCACCA Chr7:105761595..105761614 60.11 50 CATCTGCTACCCTGGATGCT Chr7:105759248..105759267 60.24 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590492 Chr7:105804984..105805079 GCACCGCAAACAAACCTAAT Chr7:105805045..105805064 60 45
upstream ENSMUSE00000672146 Chr7:105803254..105803362 GGGCTACCAGACAGAAGCAG Chr7:105803326..105803345 60.01 60
upstream ENSMUSE00000265873 Chr7:105796315..105796414 CTGGAGGCATATGCTGGAGT Chr7:105796393..105796412 60.24 55
upstream ENSMUSE00000265867 Chr7:105794959..105795033 GCTGAAGTTCGGAGAGCAGT Chr7:105794992..105795011 59.75 55
upstream ENSMUSE00000367767 Chr7:105793677..105793718 No primer for this exon
upstream ENSMUSE00000265864 Chr7:105790003..105790178 TGCAGAGACAGCAAGCAAAG Chr7:105790006..105790025 60.47 50
upstream ENSMUSE00000337067 Chr7:105785771..105786030 GGAAGTCCCAAGATGAGCAA Chr7:105785874..105785893 60.19 50
upstream ENSMUSE00000380429 Chr7:105778641..105778917 AGTCATTGCCTCCACGACTC Chr7:105778800..105778819 60.27 55
upstream ENSMUSE00000371161 Chr7:105774976..105775230 TCAGCAATCAAAGTGGCATC Chr7:105775200..105775219 59.81 45
upstream ENSMUSE00000414241 Chr7:105769901..105770050 GCAATTCCCCAATTATGGTG Chr7:105769953..105769972 60.02 45
upstream ENSMUSE00000366705 Chr7:105767809..105767979 ACCTATACCCGGCCAACAGT Chr7:105767949..105767968 60.63 55
upstream ENSMUSE00000590491 Chr7:105763986..105764122 AATGACTTCCAAGCCCAATG Chr7:105764075..105764094 59.93 45
upstream ENSMUSE00000529351 Chr7:105761494..105761667 TGCTACAAGACCCATCACCA Chr7:105761595..105761614 60.11 50

*** Putative Vector Insertion (Chr 7: 105759376 - 105761493) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000529349 Chr7:105759177..105759375 CATCTGCTACCCTGGATGCT Chr7:105759248..105759267 60.24 55
downstream ENSMUSE00000529335 Chr7:105751093..105751257 TGTTCTGACCAATCCTGACG Chr7:105751181..105751200 59.68 50
downstream ENSMUSE00000590490 Chr7:105749182..105749337 CTACCACAGCAATGGATGGA Chr7:105749193..105749212 59.52 50
downstream ENSMUSE00000633473 Chr7:105748262..105748303 AGGGGAAAAGCAACCTCTGT Chr7:105748245..105748264 60.11 50
downstream ENSMUSE00000486627 Chr7:105745543..105745694 CATGATGTGGGTGATTGCTC Chr7:105745527..105745546 59.92 50
downstream ENSMUSE00000351526 Chr7:105743262..105743822 TCGTAAAAGCGGTGTGACTG Chr7:105743773..105743792 59.9 50
downstream ENSMUSE00000265941 Chr7:105741841..105742320 TGTTGGGCTCTCTTCAGCTT Chr7:105741834..105741853 60.13 50
downstream ENSMUSE00000379916 Chr7:105739125..105739394 GGTAACCACGCAGGCTCTAA Chr7:105739136..105739155 60.27 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTAATCGCCTTGCAGCAC Chr7:105761425..105761445 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGGGAAAACACAGGTATGC Chr7:105761486..105761507 59.49 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035401