Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9316
Trapped Gene
Prkci (ENSMUSG00000037643)
Vector Insertion
Chr 3: 30895008 - 30917471
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) XH339 (baygenomics) E113B06 (ggtc)
5SE152H04 (ggtc) E069A10 (ggtc) E021F02 (ggtc) E113B06 (ggtc) E064G12 (ggtc)
3SE223B01 (ggtc) E069A10 (ggtc) (ggtc) E021F05 (ggtc) (cmhd)
PST7472-NL (escells) IST14959H7 (tigm) IST12846F8 (tigm) IST14141C9 (tigm)
IST14370H12 (tigm) IST14382H8 (tigm) IST12438H6 (tigm) IST14276G2 (tigm)
IST14212E4 (tigm)
Private Clones OST452941 (lexicon) OST426274 (lexicon) OST422984 (lexicon) OST403579 (lexicon)
OST372837 (lexicon) OST366799 (lexicon) OST360006 (lexicon) OST346215 (lexicon)
OST323481 (lexicon) OST302362 (lexicon) OST280097 (lexicon) OST264095 (lexicon)
OST259779 (lexicon) OST248802 (lexicon) OST233465 (lexicon) OST188853 (lexicon)
OST171253 (lexicon) OST154989 (lexicon) OST134812 (lexicon) OST118829 (lexicon)
OST105456 (lexicon) OST104540 (lexicon) OST66797 (lexicon) OST63896 (lexicon)
OST56195 (lexicon) OST41240 (lexicon) OST33927 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000445045 (Chr3:30894669..30895007 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCGGGTGAAAGCCTACTAC Chr3:30894982..30895002 60.01 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000445045 (Chr3:30894669..30895007 +)
Downstram Exon
ENSMUSE00000273499 (Chr3:30917472..30917593 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCGGGTGAAAGCCTACTAC Chr3:30894982..30895002 60.01 57.14 TCACTGCAAAGTCCCTCAAA Chr3:30917531..30917550 59.42 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445045 Chr3:30894669..30895007 GTCCGGGTGAAAGCCTACTAC Chr3:30894982..30895002 60.01 57.14

*** Putative Vector Insertion (Chr 3: 30895008 - 30917471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273499 Chr3:30917472..30917593 TCACTGCAAAGTCCCTCAAA Chr3:30917531..30917550 59.42 45
downstream ENSMUSE00000273487 Chr3:30924052..30924141 AGCTCGTACAGCCTGAAAGC Chr3:30924115..30924134 59.79 55
downstream ENSMUSE00000273474 Chr3:30925175..30925225 GACGCTCTGGTACACATGGA Chr3:30925201..30925220 59.71 55
downstream ENSMUSE00000273464 Chr3:30928408..30928493 CCCTCTCCGGTAAATGGACT Chr3:30928430..30928449 60.32 55
downstream ENSMUSE00000273454 Chr3:30930006..30930146 CCCACACTCAATTGTGACCA Chr3:30930131..30930150 60.42 50
downstream ENSMUSE00000273444 Chr3:30932100..30932151 No primer for this exon
downstream ENSMUSE00000273437 Chr3:30933421..30933479 TGGTCCAAACTCTCATGACTTG Chr3:30933461..30933482 60.15 45.46
downstream ENSMUSE00000273428 Chr3:30936768..30936944 ACTGGACGACGCTTTACCAC Chr3:30936809..30936828 60.18 55
downstream ENSMUSE00000569053 Chr3:30937372..30937469 CCGACAAGAAAAGGGTGATT Chr3:30937442..30937461 59.03 45
downstream ENSMUSE00000569052 Chr3:30937951..30938037 TGAGGTCCCCTCCATTTACA Chr3:30937994..30938013 60.31 50
downstream ENSMUSE00000273403 Chr3:30938290..30938425 TCCCTCGCTCATGAAGATAA Chr3:30938345..30938364 58.4 45
downstream ENSMUSE00000273399 Chr3:30940364..30940451 GCAGAAAGTGCTGGTTGTGT Chr3:30940405..30940424 58.94 50
downstream ENSMUSE00000273390 Chr3:30942613..30942738 GCTCCCAACGATATCAAACG Chr3:30942698..30942717 60.47 50
downstream ENSMUSE00000273384 Chr3:30943804..30943883 No primer for this exon
downstream ENSMUSE00000273378 Chr3:30945395..30945484 ACAACCCAATCGTTCCTTTG Chr3:30945421..30945440 59.83 45
downstream ENSMUSE00000273376 Chr3:30945894..30946009 GGAGTGAGCTGGACTGGTTC Chr3:30946003..30946022 59.84 60
downstream ENSMUSE00000444307 Chr3:30949112..30951659 TAGCAGCTTAGGGCGTGAAT Chr3:30950855..30950874 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGTCCTCCTTGATAGCAT Chr3:30897967..30897988 59.85 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGTCGTGACTGGGAAAA Chr3:30910053..30910073 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037643