Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9333
Trapped Gene
Cdc123 (ENSMUSG00000039128)
Vector Insertion
Chr 2: 5754760 - 5762998
Public Clones XC100 (baygenomics) XH587 (baygenomics)
Private Clones OST307698 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313235 (Chr2:5762999..5763070 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGATGGGACTCTGGTGGT Chr2:5763008..5763027 59.77 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313235 (Chr2:5762999..5763070 -)
Downstram Exon
ENSMUSE00000313230 (Chr2:5754702..5754759 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGATGGGACTCTGGTGGT Chr2:5763008..5763027 59.77 55 GTCTGACTGGGAGCATGTTG Chr2:5754707..5754726 59.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000647790 Chr2:5765881..5765987 TGGTACCCACTTTTCCGAAG Chr2:5765896..5765915 59.96 50
upstream ENSMUSE00000313235 Chr2:5762999..5763070 GATGATGGGACTCTGGTGGT Chr2:5763008..5763027 59.77 55

*** Putative Vector Insertion (Chr 2: 5754760 - 5762998) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000313230 Chr2:5754702..5754759 GTCTGACTGGGAGCATGTTG Chr2:5754707..5754726 59.26 55
downstream ENSMUSE00000313225 Chr2:5754127..5754159 TGTGGCTGTGCTCTCATCAT Chr2:5754111..5754130 60.44 50
downstream ENSMUSE00000313217 Chr2:5744148..5744243 CTTGGGGCACTCCAGTTAAG Chr2:5744127..5744146 59.73 55
downstream ENSMUSE00000313205 Chr2:5742322..5742428 GGAACTGTTCATCGCTATCCA Chr2:5742377..5742397 60.09 47.62
downstream ENSMUSE00000313200 Chr2:5731842..5731890 CAAGGGTCTGGAGAGTCATCA Chr2:5731833..5731853 60.24 52.38
downstream ENSMUSE00000647789 Chr2:5730969..5731064 GGAGAGCAGGTAGGTTGTGG Chr2:5730971..5730990 59.72 60
downstream ENSMUSE00000313190 Chr2:5728477..5728552 CACACCATTTTCGGAGAACA Chr2:5728509..5728528 59.54 45
downstream ENSMUSE00000313185 Chr2:5725957..5726079 TTGAATGCATCTGCAAATTTCT Chr2:5725981..5726002 59.73 31.82
downstream ENSMUSE00000313177 Chr2:5724993..5725021 No primer for this exon
downstream ENSMUSE00000313169 Chr2:5719407..5719535 TGACCTCCCCAAATGGATTA Chr2:5719471..5719490 60.13 45
downstream ENSMUSE00000313161 Chr2:5716595..5716732 CCGGTGGAAAGGTCTACAAA Chr2:5716610..5716629 59.96 50
downstream ENSMUSE00000364658 Chr2:5715713..5715926 CTCAGTCGTCCTCTTGCTCA Chr2:5715877..5715896 59.28 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGATGGGACTCTGGTGGTC Chr2:5760005..5760025 59.77 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGATGGGACTCTGGTGGTC Chr2:5760005..5760025 59.77 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039128