Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9345
Trapped Gene
CT030170.10 (ENSMUSG00000079167)
Vector Insertion
Chr 12: 17907593 - 17907792
Public Clones XH711 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655875 (Chr12:17907466..17907592 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAAGAGTGGAATTTGCTG Chr12:17907506..17907525 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655875 (Chr12:17907466..17907592 +)
Downstram Exon
ENSMUSE00000686286 (Chr12:17907793..17907853 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAAGAGTGGAATTTGCTG Chr12:17907506..17907525 59.67 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655829 Chr12:17888720..17889128 No primer for this exon
upstream ENSMUSE00000655875 Chr12:17907466..17907592 GGGAAGAGTGGAATTTGCTG Chr12:17907506..17907525 59.67 50

*** Putative Vector Insertion (Chr 12: 17907593 - 17907792) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000686286 Chr12:17907793..17907853 No primer for this exon
downstream ENSMUSE00000686285 Chr12:17940179..17940562 GGAAGCCCTTCTACCACTCC Chr12:17940293..17940312 60.07 60
downstream ENSMUSE00000686284 Chr12:17941954..17942059 ATCACGGAGGACACCATCTT Chr12:17941985..17942004 59.38 50
downstream ENSMUSE00000466441 Chr12:17945595..17946436 ATGCCAAGTCAATGGAAAGG Chr12:17946418..17946437 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr12:17907644..17907664 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000079167