Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9349
Trapped Gene
Dvl2 (ENSMUSG00000020888)
Vector Insertion
Chr 11: 69822645 - 69823612
Public Clones XH743 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000578675 (Chr11:69822646..69823611 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000578675 (Chr11:69822646..69823611 +)
Downstram Exon
ENSMUSE00000661981 (Chr11:69822646..69824279 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661983 Chr11:69814097..69814528 No primer for this exon
upstream ENSMUSE00000709546 Chr11:69814097..69814528 No primer for this exon
upstream ENSMUSE00000578678 Chr11:69818307..69818376 No primer for this exon
upstream ENSMUSE00000111521 Chr11:69818657..69818802 No primer for this exon
upstream ENSMUSE00000111531 Chr11:69818939..69819048 No primer for this exon
upstream ENSMUSE00000111523 Chr11:69819164..69819299 No primer for this exon
upstream ENSMUSE00000111510 Chr11:69819440..69819530 No primer for this exon
upstream ENSMUSE00000111520 Chr11:69819638..69819707 No primer for this exon
upstream ENSMUSE00000578677 Chr11:69819793..69819932 No primer for this exon
upstream ENSMUSE00000578676 Chr11:69820016..69820092 No primer for this exon
upstream ENSMUSE00000111533 Chr11:69820955..69821022 No primer for this exon
upstream ENSMUSE00000111518 Chr11:69821317..69821445 No primer for this exon
upstream ENSMUSE00000111513 Chr11:69821522..69821653 No primer for this exon
upstream ENSMUSE00000111514 Chr11:69821783..69821962 No primer for this exon
upstream ENSMUSE00000661982 Chr11:69822279..69822497 No primer for this exon

*** Putative Vector Insertion (Chr 11: 69822645 - 69823612) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578675 Chr11:69822646..69823611 No primer for this exon
downstream ENSMUSE00000661981 Chr11:69822646..69824279 No primer for this exon
downstream ENSMUSE00000661980 Chr11:69824379..69825803 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTCTGGGCTGAGCTTCAT Chr11:69822599..69822619 59.56 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTCTGGGCTGAGCTTCAT Chr11:69822599..69822619 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020888