Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9368
Trapped Gene
Phip (ENSMUSG00000032253)
Vector Insertion
Chr 9: 82839526 - 82853118
Public Clones XE488 (baygenomics) XH239 (baygenomics)
Private Clones OST431235 (lexicon) OST407487 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218161 (Chr9:82853119..82853217 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACGGTAGCCCACCTAGCA Chr9:82853122..82853141 60.28 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218161 (Chr9:82853119..82853217 -)
Downstram Exon
ENSMUSE00000218166 (Chr9:82839365..82839525 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACGGTAGCCCACCTAGCA Chr9:82853122..82853141 60.28 60 TAAATATCCGCCTGCCAGTT Chr9:82839345..82839364 59.57 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414720 Chr9:82868859..82869096 CATGTCTCGTGAGAGGAAAGG Chr9:82868879..82868899 59.85 52.38
upstream ENSMUSE00000368868 Chr9:82868695..82868753 AAGATGGACCCTGTCAGCAG Chr9:82868704..82868723 60.26 55
upstream ENSMUSE00000349745 Chr9:82868534..82868563 No primer for this exon
upstream ENSMUSE00000328622 Chr9:82868281..82868340 CCCCAGGACCTACCAGAATC Chr9:82868283..82868302 60.7 60
upstream ENSMUSE00000218128 Chr9:82853308..82853458 TCATCGGCTAGGACCTCTTC Chr9:82853392..82853411 59.39 55
upstream ENSMUSE00000218161 Chr9:82853119..82853217 CTACGGTAGCCCACCTAGCA Chr9:82853122..82853141 60.28 60

*** Putative Vector Insertion (Chr 9: 82839526 - 82853118) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218166 Chr9:82839365..82839525 TAAATATCCGCCTGCCAGTT Chr9:82839345..82839364 59.57 45
downstream ENSMUSE00000531480 Chr9:82826453..82826674 AGGTGCACAGGTTCGAAGAC Chr9:82826476..82826495 60.31 55
downstream ENSMUSE00000218150 Chr9:82826093..82826193 TCTTTGAGCCACTGCACAAT Chr9:82826144..82826163 59.44 45
downstream ENSMUSE00000218149 Chr9:82823911..82823981 No primer for this exon
downstream ENSMUSE00000218144 Chr9:82822582..82822682 CTTCCAGTGGCCAAAAACAT Chr9:82822636..82822655 59.97 45
downstream ENSMUSE00000531477 Chr9:82822436..82822476 No primer for this exon
downstream ENSMUSE00000218152 Chr9:82821707..82821805 GTGCTGTCCCATCACGACTA Chr9:82821752..82821771 59.71 55
downstream ENSMUSE00000218126 Chr9:82820642..82820795 CATGTCGATCCCAAGCTACC Chr9:82820703..82820722 60.48 55
downstream ENSMUSE00000218164 Chr9:82820004..82820138 AATGGGTGTGGCTCAAGAAC Chr9:82820076..82820095 59.97 50
downstream ENSMUSE00000531474 Chr9:82808903..82809031 TTGCTACTGGACCCAAAACC Chr9:82808891..82808910 59.97 50
downstream ENSMUSE00000218136 Chr9:82807295..82807520 AACCAATCGCTGGTACCTTG Chr9:82807334..82807353 59.99 50
downstream ENSMUSE00000218125 Chr9:82803394..82803531 CACGGCTGGCATTACTAACA Chr9:82803381..82803400 59.75 50
downstream ENSMUSE00000218148 Chr9:82802298..82802481 CTGCCGTACACCTTCGATTT Chr9:82802377..82802396 60.13 50
downstream ENSMUSE00000218155 Chr9:82800548..82800665 TCCCTTTGCAGTTCTCCATT Chr9:82800613..82800632 59.67 45
downstream ENSMUSE00000218162 Chr9:82799256..82799396 CTCTAAGGGCCTGGGTGTTT Chr9:82799264..82799283 60.49 55
downstream ENSMUSE00000218153 Chr9:82796731..82796807 CTTCCTCAGAAGTCCCACCA Chr9:82796743..82796762 60.23 55
downstream ENSMUSE00000493659 Chr9:82794229..82794460 TCTTTGGTGGCTGCAAGTTA Chr9:82794374..82794393 59.46 45
downstream ENSMUSE00000218140 Chr9:82789629..82789748 GCTGAAGGCAACCACTCTTC Chr9:82789665..82789684 60 55
downstream ENSMUSE00000218143 Chr9:82787841..82787948 TTTTATTTTTCCGGGCCATT Chr9:82787869..82787888 60.48 35
downstream ENSMUSE00000328935 Chr9:82787132..82787256 GGTAAATGATCCACCGGTCA Chr9:82787115..82787134 60.58 50
downstream ENSMUSE00000328921 Chr9:82786930..82787012 TGACGTCAGGCATATCATGG Chr9:82786968..82786987 60.5 50
downstream ENSMUSE00000328905 Chr9:82783968..82784079 CAAACCACCAGGCATCATCT Chr9:82784016..82784035 60.92 50
downstream ENSMUSE00000218147 Chr9:82783721..82783782 No primer for this exon
downstream ENSMUSE00000218123 Chr9:82781121..82781276 CCCATTCTCCATCAAGAGGT Chr9:82781165..82781184 58.94 50
downstream ENSMUSE00000218163 Chr9:82780229..82780349 GTTGGATAGGCCACCACAGT Chr9:82780252..82780271 59.85 55
downstream ENSMUSE00000218160 Chr9:82778440..82778565 TGGCTCATTGAATGTTCGTG Chr9:82778477..82778496 60.67 45
downstream ENSMUSE00000218146 Chr9:82775277..82775346 No primer for this exon
downstream ENSMUSE00000218135 Chr9:82774928..82774978 GAAGTCCCTGGAACATCAGC Chr9:82774922..82774941 59.66 55
downstream ENSMUSE00000218142 Chr9:82773719..82773868 CACTGGCTGTCGAAAAGGTT Chr9:82773715..82773734 60.29 50
downstream ENSMUSE00000218134 Chr9:82770797..82770949 CCATGGGTGACTCATAATTCC Chr9:82770843..82770863 59.12 47.62
downstream ENSMUSE00000218124 Chr9:82770333..82770496 CTGCTCCTGTTTCGCTTCTT Chr9:82770338..82770357 59.76 50
downstream ENSMUSE00000218127 Chr9:82769616..82769875 CATTTGCGCAGCATTATGTC Chr9:82769742..82769761 60.24 45
downstream ENSMUSE00000218139 Chr9:82768897..82769094 TATGACTGCGGCTGACTTTG Chr9:82768882..82768901 60.01 50
downstream ENSMUSE00000380837 Chr9:82759766..82765468 TTTCTGCCTCCACGACTCTT Chr9:82765131..82765150 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTGATAATCGCCTTGCAG Chr9:82853053..82853073 59.02 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCTCCAAATTTTGCTGCTT Chr9:82853071..82853092 59.88 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032253