Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9385
Trapped Gene
Sdad1 (ENSMUSG00000029415)
Vector Insertion
Chr 5: 92723048 - 92725036
Public Clones XH155 (baygenomics) W015C08 (ggtc) CMHD-GT_314D12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000188699 (Chr5:92725037..92725094 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTTTTGTGCAAAGGTTTC Chr5:92725055..92725074 59.59 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000188699 (Chr5:92725037..92725094 -)
Downstram Exon
ENSMUSE00000188719 (Chr5:92722989..92723047 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTTTTGTGCAAAGGTTTC Chr5:92725055..92725074 59.59 45 ACCAGGTGATGAGAGGCTTG Chr5:92722977..92722996 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000395659 Chr5:92738818..92739050 GGACCCACGAGTCTAAGCTG Chr5:92738986..92739005 59.87 60
upstream ENSMUSE00000360481 Chr5:92734759..92734863 CCAAATAAGCCCAGCAAAGA Chr5:92734790..92734809 60.2 45
upstream ENSMUSE00000409100 Chr5:92734230..92734328 ACCCGGAGCATCTCAGTAAC Chr5:92734296..92734315 59.17 55
upstream ENSMUSE00000188697 Chr5:92733999..92734109 ACGTTTTGCAAAGCCTTGAT Chr5:92734090..92734109 59.75 40
upstream ENSMUSE00000188668 Chr5:92732910..92732981 AACATCAACGCCAAACACAA Chr5:92732929..92732948 60.01 40
upstream ENSMUSE00000188677 Chr5:92732692..92732792 CCTTGGATGTGATGATCGAA Chr5:92732712..92732731 59.45 45
upstream ENSMUSE00000188707 Chr5:92731665..92731722 CACAACTGCGTGTTTCTCCA Chr5:92731676..92731695 60.91 50
upstream ENSMUSE00000188683 Chr5:92730838..92730912 GCTGCTTTGACGTTCTTCCT Chr5:92730884..92730903 59.62 50
upstream ENSMUSE00000188703 Chr5:92729088..92729189 GTATGCCACGGGAAAGAAAG Chr5:92729135..92729154 59.57 50
upstream ENSMUSE00000188681 Chr5:92727218..92727287 No primer for this exon
upstream ENSMUSE00000188701 Chr5:92726146..92726249 GCTGTAAGGAGCGGTTTGAG Chr5:92726197..92726216 60.01 55
upstream ENSMUSE00000188699 Chr5:92725037..92725094 CCCTTTTGTGCAAAGGTTTC Chr5:92725055..92725074 59.59 45

*** Putative Vector Insertion (Chr 5: 92723048 - 92725036) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188719 Chr5:92722989..92723047 ACCAGGTGATGAGAGGCTTG Chr5:92722977..92722996 60.26 55
downstream ENSMUSE00000188693 Chr5:92721679..92721755 CGTCACAAGCAACGACTGAA Chr5:92721710..92721729 61.05 50
downstream ENSMUSE00000188671 Chr5:92720912..92721009 CAGAGGACATCGAGCTGTGA Chr5:92720948..92720967 60.14 55
downstream ENSMUSE00000188706 Chr5:92720733..92720809 CAAAGTCCTGGCAGACATCA Chr5:92720762..92720781 59.83 50
downstream ENSMUSE00000321917 Chr5:92720039..92720165 ACCTCTGCTCCTGGGATGTA Chr5:92720058..92720077 59.68 55
downstream ENSMUSE00000402972 Chr5:92719284..92719378 GTCAACCCACTCACCATCCT Chr5:92719298..92719317 59.82 55
downstream ENSMUSE00000188675 Chr5:92718947..92719137 CATGCGGATTTTCTGGAAGT Chr5:92719011..92719030 60.07 45
downstream ENSMUSE00000188717 Chr5:92718766..92718850 No primer for this exon
downstream ENSMUSE00000188685 Chr5:92717493..92717654 GCTGTTTTTGACCGGACATT Chr5:92717493..92717512 59.98 45
downstream ENSMUSE00000388708 Chr5:92713036..92715896 TGACCCAGCAGCCTAGAACT Chr5:92714371..92714390 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTGTGTGTGCTCCTTGCT Chr5:92725009..92725029 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTGTGTGTGCTCCTTGCT Chr5:92725009..92725029 59.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029415