Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9402
Trapped Gene
Chmp1a (ENSMUSG00000000743)
Vector Insertion
Chr 8: 125734136 - 125736565
Public Clones (sanger) XC472 (baygenomics) XC766 (baygenomics) XH334 (baygenomics)
IST11593E2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678268 (Chr8:125736566..125736660 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678268 (Chr8:125736566..125736660 -)
Downstram Exon
ENSMUSE00000678267 (Chr8:125734116..125734135 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678268 Chr8:125736566..125736660 No primer for this exon

*** Putative Vector Insertion (Chr 8: 125734136 - 125736565) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678267 Chr8:125734116..125734135 No primer for this exon
downstream ENSMUSE00000215219 Chr8:125732921..125732998 No primer for this exon
downstream ENSMUSE00000215220 Chr8:125731864..125732010 No primer for this exon
downstream ENSMUSE00000215222 Chr8:125731373..125731501 No primer for this exon
downstream ENSMUSE00000403072 Chr8:125730044..125730231 No primer for this exon
downstream ENSMUSE00000633865 Chr8:125728169..125729646 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGTCTAATCGCCTTGCAG Chr8:125736500..125736520 60.93 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGGTAAGGGGCTGTCATC Chr8:125736548..125736568 61.82 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000743