Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9426
Trapped Gene
Nus1 (ENSMUSG00000023068)
Vector Insertion
Chr 10: 52150023 - 52153150
Public Clones RRD189 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000133320 (Chr10:52149873..52150022 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGTTAGTAGCCCAGCAG Chr10:52149954..52149973 60.04 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000133320 (Chr10:52149873..52150022 +)
Downstram Exon
ENSMUSE00000133319 (Chr10:52153151..52153250 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGTTAGTAGCCCAGCAG Chr10:52149954..52149973 60.04 60 CTGATTTGCCAGGGAAGAAA Chr10:52153238..52153257 60.18 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411272 Chr10:52137365..52137974 CTGTTGGTCACGGAGGAAGT Chr10:52137866..52137885 60.15 55
upstream ENSMUSE00000302205 Chr10:52148999..52149124 CTTTTGGGCCAAGATTGTTC Chr10:52149058..52149077 59.55 45
upstream ENSMUSE00000133320 Chr10:52149873..52150022 GCCAGTTAGTAGCCCAGCAG Chr10:52149954..52149973 60.04 60

*** Putative Vector Insertion (Chr 10: 52150023 - 52153150) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000133319 Chr10:52153151..52153250 CTGATTTGCCAGGGAAGAAA Chr10:52153238..52153257 60.18 45
downstream ENSMUSE00000362324 Chr10:52156383..52156570 GGCGGAGAAGAAGTCCTCAT Chr10:52156434..52156453 60.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGAGGCTTCCGAAGAGAA Chr10:52150052..52150072 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGGTGGAAATATTCAGA Chr10:52150034..52150054 60.13 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023068