Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9428
Trapped Gene
Rprd2 (ENSMUSG00000028106)
Vector Insertion
Chr 3: 95594153 - 95622469
Public Clones XE369 (baygenomics) RRD192 (baygenomics) W044A07 (ggtc) E021D11 (ggtc)
W045D01 (ggtc) W044B05 (ggtc) W045C06 (ggtc) (cmhd) CMHD-GT_404C9-3 (cmhd)
CMHD-GT_534C7-3 (cmhd) FHCRC-GT-S15-1G1 (fhcrc) IST13224D2 (tigm) IST14462B3 (tigm)
IST14979G4 (tigm) IST14972E4 (tigm) IST12911A4 (tigm)
Private Clones OST444492 (lexicon) OST389469 (lexicon) OST378798 (lexicon) OST360215 (lexicon)
OST309108 (lexicon) OST267970 (lexicon) OST230965 (lexicon) OST192529 (lexicon)
OST174998 (lexicon) OST170995 (lexicon) OST166256 (lexicon) OST138257 (lexicon)
OST96093 (lexicon) OST34489 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000566196 (Chr3:95622470..95622876 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTTGTCGTCCTGGTGTAT Chr3:95622529..95622548 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000566196 (Chr3:95622470..95622876 -)
Downstram Exon
ENSMUSE00000176218 (Chr3:95594023..95594152 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTTGTCGTCCTGGTGTAT Chr3:95622529..95622548 60 55 TCAGGAAGCACATCAGCAAA Chr3:95594019..95594038 60.54 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000566196 Chr3:95622470..95622876 GGCTTGTCGTCCTGGTGTAT Chr3:95622529..95622548 60 55

*** Putative Vector Insertion (Chr 3: 95594153 - 95622469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176218 Chr3:95594023..95594152 TCAGGAAGCACATCAGCAAA Chr3:95594019..95594038 60.54 45
downstream ENSMUSE00000392753 Chr3:95591207..95591307 No primer for this exon
downstream ENSMUSE00000176217 Chr3:95590243..95590320 TTCCACTGCTTATTCGGTTG Chr3:95590232..95590251 58.77 45
downstream ENSMUSE00000566202 Chr3:95590243..95590374 TTTGCAGTCTGGCATTATGG Chr3:95590317..95590336 59.69 45
downstream ENSMUSE00000176223 Chr3:95588977..95589029 CAGCTTTTGGATTCGTGGAT Chr3:95588987..95589006 60.07 45
downstream ENSMUSE00000393155 Chr3:95588137..95588263 CTCTTCAATGAGGGCCTGAG Chr3:95588221..95588240 59.94 55
downstream ENSMUSE00000448226 Chr3:95584338..95584513 CTGTTAGTGAGGGCCCATTT Chr3:95584381..95584400 59.05 50
downstream ENSMUSE00000448220 Chr3:95580438..95580720 CTCGGTTAGCGAAGGTTTTG Chr3:95580674..95580693 59.88 50
downstream ENSMUSE00000448213 Chr3:95578183..95578295 ACCAGTGGAGACAGCAGGTT Chr3:95578224..95578243 59.76 55
downstream ENSMUSE00000448268 Chr3:95578064..95578180 AAAACCAAAGTTGGGGAAGG Chr3:95578090..95578109 60.19 45
downstream ENSMUSE00000566199 Chr3:95578035..95578295 AAAACCAAAGTTGGGGAAGG Chr3:95578090..95578109 60.19 45
downstream ENSMUSE00000566198 Chr3:95575919..95576119 GTTGCTGGGACTGGTAGGAA Chr3:95576045..95576064 60.11 55
downstream ENSMUSE00000566197 Chr3:95563796..95570343 ACAGCTGAGGCCTAACTCCA Chr3:95564490..95564509 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCTGGAGAGATGGAGAAA Chr3:95619420..95619440 58.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCTGGAGAGATGGAGAAA Chr3:95619420..95619440 58.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AATTCTGTGCTAATCGCCTTG Chr3:95619815..95619836 59.38 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTAATTCTGTGCCGTGACTGG Chr3:95607817..95607838 60.69 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028106