Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9455
Trapped Gene
Rras2 (ENSMUSG00000055723)
Vector Insertion
Chr 7: 121202544 - 121203845
Public Clones RRD073 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000527809 (Chr7:121203846..121203933 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGACTATGATCCAACCATTG Chr7:121203900..121203920 60.2 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000527809 (Chr7:121203846..121203933 -)
Downstram Exon
ENSMUSE00000527808 (Chr7:121202441..121202543 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGACTATGATCCAACCATTG Chr7:121203900..121203920 60.2 47.62 ACTCCTCTTGTCCGGCTGTA Chr7:121202495..121202514 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000588859 Chr7:121260910..121261295 GCTCACCATCCAGTTCATCC Chr7:121260912..121260931 60.48 55
upstream ENSMUSE00000527809 Chr7:121203846..121203933 CGGACTATGATCCAACCATTG Chr7:121203900..121203920 60.2 47.62

*** Putative Vector Insertion (Chr 7: 121202544 - 121203845) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000527808 Chr7:121202441..121202543 ACTCCTCTTGTCCGGCTGTA Chr7:121202495..121202514 59.87 55
downstream ENSMUSE00000527807 Chr7:121202054..121202162 GGAAACTCATCACGGTCCTT Chr7:121202078..121202097 58.99 50
downstream ENSMUSE00000436813 Chr7:121193815..121193933 GAGCTGCCTTGCTAACTGCT Chr7:121193873..121193892 59.93 55
downstream ENSMUSE00000504249 Chr7:121190302..121191765 GGGGACACTGAACGTGACTT Chr7:121190534..121190553 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCTCTGTAATCGCCTTGC Chr7:121203782..121203802 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000055723