Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9459
Trapped Gene
Baz2a (ENSMUSG00000040054)
Vector Insertion
Chr 10: 127548405 - 127549637
Public Clones RRD099 (baygenomics) PST10752-NR (escells) IST13034C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000272816 (Chr10:127547811..127548404 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCTGATGAAGCAGCAGA Chr10:127548308..127548327 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000272816 (Chr10:127547811..127548404 +)
Downstram Exon
ENSMUSE00000272811 (Chr10:127549638..127549823 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCTGATGAAGCAGCAGA Chr10:127548308..127548327 60.1 50 CAGAGAGTCAAAGGGCTCCA Chr10:127549819..127549838 60.52 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665442 Chr10:127496046..127496082 No primer for this exon
upstream ENSMUSE00000665441 Chr10:127533493..127533579 GGATTCTCTCCAACGACCAA Chr10:127533494..127533513 60.05 50
upstream ENSMUSE00000629097 Chr10:127545950..127546087 GGAGGCAAACGACCATTTTA Chr10:127545954..127545973 59.94 45
upstream ENSMUSE00000272816 Chr10:127547811..127548404 CATCCTGATGAAGCAGCAGA Chr10:127548308..127548327 60.1 50

*** Putative Vector Insertion (Chr 10: 127548405 - 127549637) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000272811 Chr10:127549638..127549823 CAGAGAGTCAAAGGGCTCCA Chr10:127549819..127549838 60.52 55
downstream ENSMUSE00000272806 Chr10:127550519..127550737 CATCAGCTCCGCATCATCTA Chr10:127550568..127550587 59.93 50
downstream ENSMUSE00000272801 Chr10:127551390..127551839 CCTCCAGTCGTCTCTTCTCG Chr10:127551819..127551838 60.13 60
downstream ENSMUSE00000272794 Chr10:127552081..127552141 CTGGAGGGGAAGACGAACTT Chr10:127552139..127552158 60.62 55
downstream ENSMUSE00000272786 Chr10:127553117..127553225 CCTTCTTGATGCGCACTTCT Chr10:127553148..127553167 60.54 50
downstream ENSMUSE00000272778 Chr10:127553362..127553463 ACCACATTTCGGCTCAGGTA Chr10:127553384..127553403 60.52 50
downstream ENSMUSE00000471272 Chr10:127553603..127553813 GTTTGCCAGTGATTGCTTGA Chr10:127553672..127553691 59.85 45
downstream ENSMUSE00000272762 Chr10:127555611..127555711 GTCTGACTTTCTCCCCGTTG Chr10:127555698..127555717 59.7 55
downstream ENSMUSE00000272755 Chr10:127556011..127556076 GCTCTTGGTGTCTTGCTTCC Chr10:127556046..127556065 60 55
downstream ENSMUSE00000272747 Chr10:127556326..127556556 TTCCCCTTCGCTTTTACCTT Chr10:127556417..127556436 60.07 45
downstream ENSMUSE00000272740 Chr10:127556680..127556934 AGACCAGGATCATGGAGTGC Chr10:127556921..127556940 60.08 55
downstream ENSMUSE00000272733 Chr10:127558167..127558381 AGGAAGCAGCGCAGTATCTC Chr10:127558249..127558268 59.75 55
downstream ENSMUSE00000272723 Chr10:127558647..127558721 GGCCTTCAACAATCCACTTG Chr10:127558714..127558733 60.49 50
downstream ENSMUSE00000272717 Chr10:127558856..127559036 TTCCTCCATGATCCGAGAAC Chr10:127558961..127558980 60.01 50
downstream ENSMUSE00000272710 Chr10:127559124..127559183 ATATGGCGCTCTAGCTCTGG Chr10:127559170..127559189 59.6 55
downstream ENSMUSE00000272698 Chr10:127559362..127559506 CTTCCGATCCTTCCACAAAG Chr10:127559500..127559519 59.67 50
downstream ENSMUSE00000272690 Chr10:127560080..127560711 GAACTTGAGTCTGGGCTTGC Chr10:127560313..127560332 60 55
downstream ENSMUSE00000272684 Chr10:127560822..127561044 GAACTTGCTAGGGGGTCTCC Chr10:127560989..127561008 60.07 60
downstream ENSMUSE00000272674 Chr10:127561163..127561318 CCTTGAGCAGGACATCCAGT Chr10:127561225..127561244 60.26 55
downstream ENSMUSE00000272667 Chr10:127561391..127561542 GACCAGCTCATAACGCCTTC Chr10:127561451..127561470 59.84 55
downstream ENSMUSE00000272659 Chr10:127561949..127562238 TAGGGCCTTCTCCACTACCA Chr10:127562197..127562216 59.69 55
downstream ENSMUSE00000272646 Chr10:127562325..127562457 GACACGAGGGGTGATCTCAT Chr10:127562352..127562371 59.93 55
downstream ENSMUSE00000272638 Chr10:127562555..127562701 TTGGGCCGATGACAGTAAAT Chr10:127562652..127562671 60.33 45
downstream ENSMUSE00000272633 Chr10:127563074..127563297 TGGACTATCTCGGCTCCTTG Chr10:127563208..127563227 60.35 55
downstream ENSMUSE00000272627 Chr10:127563382..127563525 CATCATGGGACTCCATCTCC Chr10:127563416..127563435 60.29 55
downstream ENSMUSE00000395665 Chr10:127563644..127566359 CCTGCTGAAAAGATTGCACA Chr10:127565019..127565038 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTGTGAGCTGGGAGTGGA Chr10:127548416..127548436 61.46 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTGTGAGCTGGGAGTGGA Chr10:127548416..127548436 61.46 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040054