Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9485
Trapped Gene
Mme (ENSMUSG00000027820)
Vector Insertion
Chr 3: 63104937 - 63130635
Public Clones (sanger) RST377 (baygenomics) NST005 (baygenomics)
Private Clones OST406606 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173285 (Chr3:63104901..63104936 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173285 (Chr3:63104901..63104936 +)
Downstram Exon
ENSMUSE00000173291 (Chr3:63130636..63130797 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAACTGGTCTCGGGAATGAC Chr3:63130747..63130766 59.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441075 Chr3:63099794..63099871 No primer for this exon
upstream ENSMUSE00000674702 Chr3:63100106..63100244 CCATTCCGCTGTACAGACAC Chr3:63100203..63100222 59.17 55
upstream ENSMUSE00000371119 Chr3:63104047..63104216 CATAGCGGTGACAATGATCG Chr3:63104176..63104195 60.1 50
upstream ENSMUSE00000173285 Chr3:63104901..63104936 No primer for this exon

*** Putative Vector Insertion (Chr 3: 63104937 - 63130635) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173291 Chr3:63130636..63130797 GAACTGGTCTCGGGAATGAC Chr3:63130747..63130766 59.51 55
downstream ENSMUSE00000173280 Chr3:63131707..63131787 TTTTTGCTTTCTGCACTGCT Chr3:63131763..63131782 58.85 40
downstream ENSMUSE00000173283 Chr3:63131894..63131989 TGTCCGCCTCTGCTATCAAT Chr3:63131921..63131940 60.76 50
downstream ENSMUSE00000173296 Chr3:63132092..63132210 TGTGCAATGGATTTCTCAGC Chr3:63132128..63132147 59.81 45
downstream ENSMUSE00000173282 Chr3:63133572..63133637 No primer for this exon
downstream ENSMUSE00000173289 Chr3:63143938..63144072 GGCAAACTTTGTTCCTGACG Chr3:63144008..63144027 60.67 50
downstream ENSMUSE00000261680 Chr3:63145829..63145930 CATTGGGTCATTTCGGTCTT Chr3:63145867..63145886 59.79 45
downstream ENSMUSE00000173287 Chr3:63147419..63147555 No primer for this exon
downstream ENSMUSE00000173284 Chr3:63147664..63147757 GGCTGAGGCTGCTTACAAGA Chr3:63147725..63147744 60.68 55
downstream ENSMUSE00000173293 Chr3:63149047..63149175 AAAAGCCGCTTCCACATAAA Chr3:63149157..63149176 59.72 40
downstream ENSMUSE00000173295 Chr3:63149976..63150074 CCGGATTTGTGCAATCAAGT Chr3:63150005..63150024 60.89 45
downstream ENSMUSE00000173298 Chr3:63151059..63151139 No primer for this exon
downstream ENSMUSE00000173297 Chr3:63152540..63152643 TCCACTTTTTCTCGGAGCTT Chr3:63152637..63152656 59.05 45
downstream ENSMUSE00000173294 Chr3:63162828..63162886 TGATTTCGGCCTGAGGAATA Chr3:63162884..63162903 60.54 45
downstream ENSMUSE00000568019 Chr3:63165854..63165973 GTTGGATTGCTGAGCACTGA Chr3:63165909..63165928 59.99 50
downstream ENSMUSE00000261620 Chr3:63168684..63168817 CCAGTCAACGAGGTCTCCAT Chr3:63168724..63168743 60.11 55
downstream ENSMUSE00000261611 Chr3:63168919..63168984 TCTGTATGCTTGGCCAATACC Chr3:63168986..63169006 59.97 47.62
downstream ENSMUSE00000261602 Chr3:63172401..63172496 CTGGGCAAAGTTCAGGAAAA Chr3:63172499..63172518 60.22 45
downstream ENSMUSE00000261590 Chr3:63172802..63172878 CATACTCTGGCCGGTAGGTC Chr3:63172835..63172854 59.57 60
downstream ENSMUSE00000493048 Chr3:63184155..63186153 AAATCTTGCCGTGGATGTTC Chr3:63184292..63184311 59.94 45
downstream ENSMUSE00000674701 Chr3:63184155..63185545 AAATCTTGCCGTGGATGTTC Chr3:63184292..63184311 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACATTTTAATCGCCTTGCAG Chr3:63122981..63123002 59.27 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCAGACTGTAGGCAAGAA Chr3:63122909..63122929 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027820