Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI949
Trapped Gene
Smarcd2 (ENSMUSG00000078619)
Vector Insertion
Chr 11: 106128007 - 106128204
Public Clones BB0591 (sanger) CJ0385 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108381 (Chr11:106128205..106128327 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGATTCAAGAGGCCATCA Chr11:106128219..106128238 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108381 (Chr11:106128205..106128327 -)
Downstram Exon
ENSMUSE00000108378 (Chr11:106127851..106128006 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGATTCAAGAGGCCATCA Chr11:106128219..106128238 60.16 50 CATTATCTCCATCCGCCTTG Chr11:106127918..106127937 60.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000585666 Chr11:106133807..106134122 GGACGGGACAGAGTGATGTC Chr11:106134018..106134037 60.54 60
upstream ENSMUSE00000108385 Chr11:106128648..106128832 ATGTCACCAGGAAGCAGGAT Chr11:106128804..106128823 59.53 50
upstream ENSMUSE00000671330 Chr11:106128648..106129113 GACCTGTGTCCCTCCACTGT Chr11:106128847..106128866 60.01 60
upstream ENSMUSE00000108370 Chr11:106128452..106128494 GGAGGAAGATGGCAGATAAGG Chr11:106128466..106128486 60.05 52.38
upstream ENSMUSE00000108381 Chr11:106128205..106128327 GGAGATTCAAGAGGCCATCA Chr11:106128219..106128238 60.16 50

*** Putative Vector Insertion (Chr 11: 106128007 - 106128204) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108378 Chr11:106127851..106128006 CATTATCTCCATCCGCCTTG Chr11:106127918..106127937 60.43 50
downstream ENSMUSE00000494562 Chr11:106127202..106127297 GTTGTCCGGCCCATAGAGTT Chr11:106127192..106127211 61.27 55
downstream ENSMUSE00000576275 Chr11:106126974..106127075 GGGTGCACTTGACATTGAGA Chr11:106126975..106126994 59.68 50
downstream ENSMUSE00000108369 Chr11:106126497..106126658 AGTTGATGTACTCGCGCTCA Chr11:106126495..106126514 59.62 50
downstream ENSMUSE00000108368 Chr11:106126254..106126351 AGTCGGCCACAACTGAAGAT Chr11:106126310..106126329 59.73 50
downstream ENSMUSE00000576274 Chr11:106125986..106126121 AAGCAATCTCCTGCTGGTTG Chr11:106125978..106125997 60.4 50
downstream ENSMUSE00000671320 Chr11:106125986..106126250 CCAACCACCACGTCTATCCT Chr11:106126146..106126165 59.84 55
downstream ENSMUSE00000108374 Chr11:106125747..106125869 TGGACTCAATGGTCTCATGG Chr11:106125826..106125845 59.47 50
downstream ENSMUSE00000108379 Chr11:106125509..106125610 GGTGGTAGAAAGCAGCTCGT Chr11:106125531..106125550 59.5 55
downstream ENSMUSE00000671318 Chr11:106125113..106125610 CTCCTCAGGGTTTCCAATCA Chr11:106125556..106125575 60.04 50
downstream ENSMUSE00000410704 Chr11:106124495..106125433 GGCCCATCCTCTTTAAGACC Chr11:106124524..106124543 59.9 55
downstream ENSMUSE00000671328 Chr11:106124493..106125433 GGCCCATCCTCTTTAAGACC Chr11:106124524..106124543 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAAGAGGCCATCAAGAAGC Chr11:106128211..106128231 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGATTCAAGAGGCCATCA Chr11:106128217..106128237 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078619