Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9491
Trapped Gene
Ppib (ENSMUSG00000032383)
Vector Insertion
Chr 9: 65908208 - 65909273
Public Clones RST139 (baygenomics) RST059 (baygenomics) P085G01 (ggtc)
Private Clones OST430178 (lexicon) OST323025 (lexicon) OST311476 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219272 (Chr9:65908062..65908207 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGCAATATGAAGGTGCTC Chr9:65908089..65908108 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219272 (Chr9:65908062..65908207 +)
Downstram Exon
ENSMUSE00000471832 (Chr9:65909274..65909387 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGCAATATGAAGGTGCTC Chr9:65908089..65908108 60.38 50 TTTCCAAAGAGTCCAAAGACG Chr9:65909340..65909360 59.34 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219272 Chr9:65908062..65908207 AGCGCAATATGAAGGTGCTC Chr9:65908089..65908108 60.38 50

*** Putative Vector Insertion (Chr 9: 65908208 - 65909273) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471832 Chr9:65909274..65909387 TTTCCAAAGAGTCCAAAGACG Chr9:65909340..65909360 59.34 42.86
downstream ENSMUSE00000532521 Chr9:65910796..65910889 TCCTTGATGACACGATGGAA Chr9:65910845..65910864 60.05 45
downstream ENSMUSE00000532520 Chr9:65913294..65913478 AACTTTGCCGAAAACCACAT Chr9:65913469..65913488 59.48 40
downstream ENSMUSE00000357201 Chr9:65914102..65914428 TGGCTACCTTCGTCTGTGTG Chr9:65914304..65914323 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000032383