Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9531
Trapped Gene
Usp37 (ENSMUSG00000033364)
Vector Insertion
Chr 1: 74526324 - 74532554
Public Clones RRA128 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000271752 (Chr1:74532555..74532629 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000271752 (Chr1:74532555..74532629 -)
Downstram Exon
ENSMUSE00000271745 (Chr1:74526226..74526323 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTGCCTGTTTCAAACTCAGC Chr1:74526221..74526241 60.56 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436270 Chr1:74590749..74590860 AGGATGGTTACAACGGATGC Chr1:74590827..74590846 59.82 50
upstream ENSMUSE00000436249 Chr1:74577637..74577686 AGGTTCTGCCTGTGCAAGAG Chr1:74577649..74577668 60.59 55
upstream ENSMUSE00000435843 Chr1:74546530..74546674 ACCACTGGTAGAGCCGAAGA Chr1:74546632..74546651 59.87 55
upstream ENSMUSE00000347338 Chr1:74542204..74542427 CAGCCTGCTCGTTCACTACA Chr1:74542233..74542252 60.2 55
upstream ENSMUSE00000393309 Chr1:74539479..74539650 GCCGTCCATCAAAACAGACT Chr1:74539487..74539506 60.12 50
upstream ENSMUSE00000271774 Chr1:74536664..74536764 AACTATTCTGGGCAGCAGGA Chr1:74536711..74536730 59.84 50
upstream ENSMUSE00000271763 Chr1:74533193..74533371 TGACGCTGACATCAACACCT Chr1:74533219..74533238 60.32 50
upstream ENSMUSE00000271752 Chr1:74532555..74532629 No primer for this exon

*** Putative Vector Insertion (Chr 1: 74526324 - 74532554) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271745 Chr1:74526226..74526323 TCTGCCTGTTTCAAACTCAGC Chr1:74526221..74526241 60.56 47.62
downstream ENSMUSE00000271737 Chr1:74524621..74524705 CCTTTGATCCAGCTCTGCTC Chr1:74524630..74524649 60.1 55
downstream ENSMUSE00000271730 Chr1:74521560..74521718 GGAAAGGGGCACTCTAGGTC Chr1:74521561..74521580 60.07 60
downstream ENSMUSE00000271725 Chr1:74518129..74518260 No primer for this exon
downstream ENSMUSE00000271718 Chr1:74517870..74517993 No primer for this exon
downstream ENSMUSE00000271712 Chr1:74517111..74517301 GGCACGTGAACACTTTGGTA Chr1:74517141..74517160 59.62 50
downstream ENSMUSE00000271706 Chr1:74514841..74514958 GATTGAACGAGGAGGGAGTG Chr1:74514846..74514865 59.65 55
downstream ENSMUSE00000271698 Chr1:74513489..74513568 ATTTGTGCCTGACAAGAGCA Chr1:74513483..74513502 59.44 45
downstream ENSMUSE00000271692 Chr1:74508140..74508304 ACTTGCTGTCCGAGCTTGTT Chr1:74508208..74508227 60.06 50
downstream ENSMUSE00000271689 Chr1:74506489..74506554 TGATGCAGGAATTCACCATT Chr1:74506489..74506508 58.93 40
downstream ENSMUSE00000271685 Chr1:74502653..74502794 ATGTCACGGAGCTCTTGGAT Chr1:74502738..74502757 59.69 50
downstream ENSMUSE00000271675 Chr1:74500402..74500657 GGACTGCTGGTTGGCTTATC Chr1:74500472..74500491 59.7 55
downstream ENSMUSE00000271669 Chr1:74499261..74499427 CATACTGCTGGAGCCAATCA Chr1:74499304..74499323 59.82 50
downstream ENSMUSE00000271665 Chr1:74497069..74497129 TGTAGCCCTTTTGAGGTCGT Chr1:74497063..74497082 59.73 50
downstream ENSMUSE00000271657 Chr1:74490987..74491102 GCTCCTCAGCTTCAGCTTCT Chr1:74490982..74491001 59.07 55
downstream ENSMUSE00000271653 Chr1:74488106..74488175 TGAGCCGATAGGAATGAGGA Chr1:74488123..74488142 60.7 50
downstream ENSMUSE00000271649 Chr1:74486534..74486672 CTGCGATCTCGATCACTCTG Chr1:74486539..74486558 59.68 55
downstream ENSMUSE00000356685 Chr1:74485686..74486052 AAGGAAGCGGCACTCTTGTA Chr1:74485712..74485731 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGCCTAATCGCCTTGCAG Chr1:74526489..74526509 60.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTTGCTTTTAGCCCGTGA Chr1:74526498..74526518 59.85 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033364