Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9538
Trapped Gene
Arfgef2 (ENSMUSG00000074582)
Vector Insertion
Chr 2: 166661958 - 166668184
Public Clones XC646 (baygenomics) XC796 (baygenomics) XC671 (baygenomics) XC797 (baygenomics)
XE380 (baygenomics) XC792 (baygenomics) XC537 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639105 (Chr2:166661702..166661957 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAGCTCCCCGAGAGAGAG Chr2:166661902..166661921 60.23 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639105 (Chr2:166661702..166661957 +)
Downstram Exon
ENSMUSE00000639104 (Chr2:166668185..166668253 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAGCTCCCCGAGAGAGAG Chr2:166661902..166661921 60.23 60 CTTTCACAGCAGACGTGACC Chr2:166668256..166668275 59.47 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639110 Chr2:166631215..166631335 AGCTGACAAGGAGGTGAAGC Chr2:166631271..166631290 59.6 55
upstream ENSMUSE00000639109 Chr2:166652427..166652457 No primer for this exon
upstream ENSMUSE00000639108 Chr2:166653042..166653165 CTGCCAATCCAAGTCACCTC Chr2:166653114..166653133 60.66 55
upstream ENSMUSE00000639107 Chr2:166659971..166660117 TGATCGACAGGATCGTTGAA Chr2:166660035..166660054 60.2 45
upstream ENSMUSE00000639106 Chr2:166661113..166661292 TATCTGGCCAGCAAAAACCT Chr2:166661197..166661216 59.71 45
upstream ENSMUSE00000639105 Chr2:166661702..166661957 AGAAGCTCCCCGAGAGAGAG Chr2:166661902..166661921 60.23 60

*** Putative Vector Insertion (Chr 2: 166661958 - 166668184) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639104 Chr2:166668185..166668253 CTTTCACAGCAGACGTGACC Chr2:166668256..166668275 59.47 55
downstream ENSMUSE00000639103 Chr2:166670950..166671101 GCCGTTGGTCTGTGAGTTTT Chr2:166671062..166671081 60.16 50
downstream ENSMUSE00000639102 Chr2:166674367..166674497 GCCACTTGGTGTCCTTGAAC Chr2:166674398..166674417 60.56 55
downstream ENSMUSE00000639101 Chr2:166676543..166676777 CTGCTTAATGGCAGTGACGA Chr2:166676657..166676676 60.01 50
downstream ENSMUSE00000639100 Chr2:166677455..166677554 AATCCTCGTCAGGGTCTGAA Chr2:166677550..166677569 59.65 50
downstream ENSMUSE00000639099 Chr2:166678755..166678894 TCTTCCCTGAGCAATTTTGG Chr2:166678864..166678883 60.18 45
downstream ENSMUSE00000639098 Chr2:166680405..166680513 CTCCACCATGCACTTGAGAA Chr2:166680470..166680489 59.83 50
downstream ENSMUSE00000639097 Chr2:166681907..166682090 TCAATGCCATGCTCAATGAT Chr2:166682090..166682109 60.04 40
downstream ENSMUSE00000639096 Chr2:166684763..166684874 TACCTCGCTTGGGCTTCTTA Chr2:166684791..166684810 59.97 50
downstream ENSMUSE00000639095 Chr2:166685286..166685491 CAGGGCTGAGACGAACTCTT Chr2:166685396..166685415 59.6 55
downstream ENSMUSE00000639094 Chr2:166685814..166685898 GATGGAGTACGCCAGGACAT Chr2:166685868..166685887 59.96 55
downstream ENSMUSE00000679594 Chr2:166686025..166686196 GACTTGGTCGCAATTGTGTG Chr2:166686188..166686207 60.16 50
downstream ENSMUSE00000679593 Chr2:166687084..166687235 GGACATGGTCCAAGTGTGTG Chr2:166687224..166687243 59.85 55
downstream ENSMUSE00000679591 Chr2:166689057..166689185 CACCTCCGTGTCATCACAGT Chr2:166689125..166689144 59.58 55
downstream ENSMUSE00000639093 Chr2:166690193..166690351 TGGTGTCGATGTTTTTCTGC Chr2:166690292..166690311 59.7 45
downstream ENSMUSE00000639092 Chr2:166691180..166691327 TAGCGAGTCTTCACCCCAGT Chr2:166691247..166691266 59.87 55
downstream ENSMUSE00000639091 Chr2:166692412..166692511 ACTGCGACAACCACACTCTG Chr2:166692508..166692527 59.94 55
downstream ENSMUSE00000639090 Chr2:166692646..166692686 TTCCATCCAGTCTGGTAGAGC Chr2:166692679..166692699 59.3 52.38
downstream ENSMUSE00000639089 Chr2:166692788..166692957 CAGGCTGAACATTCGAGGAT Chr2:166692867..166692886 60.22 50
downstream ENSMUSE00000639088 Chr2:166694392..166694543 TGTTCAAATGGCCTCAGAAA Chr2:166694528..166694547 59.25 40
downstream ENSMUSE00000639087 Chr2:166695710..166695882 ACAATGTTCCCATCGTGGTC Chr2:166695850..166695869 60.65 50
downstream ENSMUSE00000639084 Chr2:166696959..166697119 AAGTGGTGCTGGAAGATGGT Chr2:166696983..166697002 59.58 50
downstream ENSMUSE00000639081 Chr2:166699076..166699206 CAAACAGGATGGGAAACCAG Chr2:166699163..166699182 60.35 50
downstream ENSMUSE00000639078 Chr2:166699363..166699492 TCAAACATGACCGTGAGTCC Chr2:166699386..166699405 59.53 50
downstream ENSMUSE00000639076 Chr2:166701993..166702128 ACGTGGTCGTCATCCACTCT Chr2:166702020..166702039 60.6 55
downstream ENSMUSE00000639073 Chr2:166703771..166703909 GAACTTCTCGCCGTTGGATA Chr2:166703844..166703863 60.21 50
downstream ENSMUSE00000639071 Chr2:166704018..166704072 ATCTGACACCTCCTCCTCCA Chr2:166704066..166704085 59.64 55
downstream ENSMUSE00000639070 Chr2:166706672..166706786 GGAGGCGTTTCTGTCTATGC Chr2:166706725..166706744 59.84 55
downstream ENSMUSE00000639069 Chr2:166711279..166711409 GTGGCAGGGTAGAACACGAT Chr2:166711372..166711391 60 55
downstream ENSMUSE00000639068 Chr2:166715769..166715937 TGATTCTCCGTCTCGATGTG Chr2:166715815..166715834 59.79 50
downstream ENSMUSE00000639067 Chr2:166717267..166717405 GCGGTTCTCATCAACGTACA Chr2:166717370..166717389 59.72 50
downstream ENSMUSE00000639065 Chr2:166719001..166719118 ATGGCTCTCGGAGTTCACAG Chr2:166719055..166719074 60.41 55
downstream ENSMUSE00000639063 Chr2:166720112..166720671 TAGAGGAAACGGTGGCATTC Chr2:166720559..166720578 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTGGGAAGGAGGAAAGGA Chr2:166667935..166667955 60.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTGGGAAGGAGGAAAGGA Chr2:166661935..166661955 60.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074582