Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9571
Trapped Gene
Zfp445 (ENSMUSG00000047036)
Vector Insertion
Chr 9: 122763936 - 122765816
Public Clones XE532 (baygenomics) XC676 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000342876 (Chr9:122765817..122765943 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCAATCTTTATCGGGATGT Chr9:122765852..122765871 59.92 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000342876 (Chr9:122765817..122765943 -)
Downstram Exon
ENSMUSE00000375471 (Chr9:122763825..122763935 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCAATCTTTATCGGGATGT Chr9:122765852..122765871 59.92 45 ATCAGAGCAGGTTTGGGAGA Chr9:122763886..122763905 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688069 Chr9:122775032..122775069 GCCATTAGGAAGAATGCTGAGT Chr9:122775048..122775069 59.75 45.46
upstream ENSMUSE00000432277 Chr9:122770827..122771377 GCAGAGGGATCTTGATGGAA Chr9:122770838..122770857 60.16 50
upstream ENSMUSE00000432254 Chr9:122766588..122766756 GACGTCCTGGCTGAACAAAC Chr9:122766590..122766609 60.7 55
upstream ENSMUSE00000388587 Chr9:122766221..122766279 CTCGGTGCCTGACTATTTCC Chr9:122766247..122766266 59.69 55
upstream ENSMUSE00000342876 Chr9:122765817..122765943 CGCAATCTTTATCGGGATGT Chr9:122765852..122765871 59.92 45

*** Putative Vector Insertion (Chr 9: 122763936 - 122765816) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000375471 Chr9:122763825..122763935 ATCAGAGCAGGTTTGGGAGA Chr9:122763886..122763905 59.8 50
downstream ENSMUSE00000494460 Chr9:122760143..122763106 CACACACCCTGCATTGAAAC Chr9:122762545..122762564 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000047036