Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9576
Trapped Gene
Mrps18a (ENSMUSG00000023967)
Vector Insertion
Chr 17: 46248079 - 46254888
Public Clones XD135 (baygenomics) XD137 (baygenomics) IST10673D10 (tigm)
Private Clones OST259534 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000414126 (Chr17:46247965..46248078 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGTTATGGCTTCCAGCTC Chr17:46248044..46248063 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000414126 (Chr17:46247965..46248078 +)
Downstram Exon
ENSMUSE00000136715 (Chr17:46254889..46254920 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGTTATGGCTTCCAGCTC Chr17:46248044..46248063 59.84 55 CAGTCGTCTTCCCTTCTTGG Chr17:46254921..46254940 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414126 Chr17:46247965..46248078 CTGGTTATGGCTTCCAGCTC Chr17:46248044..46248063 59.84 55

*** Putative Vector Insertion (Chr 17: 46248079 - 46254888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136715 Chr17:46254889..46254920 CAGTCGTCTTCCCTTCTTGG Chr17:46254921..46254940 59.84 55
downstream ENSMUSE00000136717 Chr17:46259673..46259780 GGTTAGGGGGATCTGGAGTC Chr17:46259727..46259746 59.76 60
downstream ENSMUSE00000136716 Chr17:46262239..46262362 TCCTCGATTTTTCGGTGTTC Chr17:46262339..46262358 60.05 45
downstream ENSMUSE00000136718 Chr17:46262592..46262661 CGGTTGAGCTTGGGTTTATC Chr17:46262664..46262683 59.57 50
downstream ENSMUSE00000385620 Chr17:46265454..46265854 TAGATGGGCTTGACGGACTT Chr17:46265498..46265517 59.69 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCGTGACTAATCGCCTTGC Chr17:46254122..46254142 60.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTTGAGCCTACTGTCTGC Chr17:46254102..46254122 60.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023967