Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9595
Trapped Gene
Inppl1 (ENSMUSG00000032737)
Vector Insertion
Chr 7: 108975176 - 108975267
Public Clones XE777 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222753 (Chr7:108975268..108975355 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCATGGATGGCTACGAAT Chr7:108975274..108975293 59.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222753 (Chr7:108975268..108975355 -)
Downstram Exon
ENSMUSE00000222744 (Chr7:108975020..108975175 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCATGGATGGCTACGAAT Chr7:108975274..108975293 59.78 50 TCATGGACTTGAGTGCAACC Chr7:108975124..108975143 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000521099 Chr7:108986403..108986590 CCCAGTTATCGAAAGCGAGA Chr7:108986439..108986458 60.34 50
upstream ENSMUSE00000450870 Chr7:108985085..108985465 AGCTTCCTGGTGCGAGATAG Chr7:108985121..108985140 59.6 55
upstream ENSMUSE00000222909 Chr7:108982289..108982352 TGCCAGATGGAGAGGATTTC Chr7:108982301..108982320 60.16 50
upstream ENSMUSE00000222900 Chr7:108982050..108982200 AGATGACCGAGATGCCTCAG Chr7:108982050..108982069 60.37 55
upstream ENSMUSE00000222892 Chr7:108981364..108981484 GCTCTGGCTCTACCAGCATT Chr7:108981432..108981451 59.6 55
upstream ENSMUSE00000222886 Chr7:108980989..108981129 AGAACCCTTGTCACCTCGTG Chr7:108981004..108981023 60.15 55
upstream ENSMUSE00000222875 Chr7:108980735..108980828 CTGTCGAAGGTGTTTGACCA Chr7:108980775..108980794 59.72 50
upstream ENSMUSE00000222865 Chr7:108980542..108980631 ACTTCCTGTCAGGCATCCAG Chr7:108980548..108980567 60.26 55
upstream ENSMUSE00000222856 Chr7:108980327..108980425 No primer for this exon
upstream ENSMUSE00000222849 Chr7:108980073..108980223 TTCACGCTGAGTGTGGATGT Chr7:108980150..108980169 60.32 50
upstream ENSMUSE00000222840 Chr7:108979881..108979987 CAGCGCAAGGACTTCATCTT Chr7:108979894..108979913 60.54 50
upstream ENSMUSE00000222837 Chr7:108979485..108979587 CATGAAGAACAGGCACTCCA Chr7:108979536..108979555 59.83 50
upstream ENSMUSE00000222833 Chr7:108979189..108979385 ACCACCCAAAAACGTGACAT Chr7:108979356..108979375 60.13 45
upstream ENSMUSE00000222826 Chr7:108978567..108978684 CTGTGTTGGTCAAGCCAGAA Chr7:108978631..108978650 59.87 50
upstream ENSMUSE00000222816 Chr7:108978090..108978186 CCTCATTTGGCTTCGTGAAT Chr7:108978125..108978144 60.07 45
upstream ENSMUSE00000222806 Chr7:108977668..108977806 TGACATCTCTTTGCGGTTCA Chr7:108977721..108977740 60.39 45
upstream ENSMUSE00000222800 Chr7:108977463..108977562 AGCGGGAGAAGCATAAGGTC Chr7:108977476..108977495 60.73 55
upstream ENSMUSE00000222792 Chr7:108977275..108977363 ATCTTTCCCACCCACCTACC Chr7:108977331..108977350 60.05 55
upstream ENSMUSE00000222783 Chr7:108976918..108976999 GGTGTGACCGGATTCTATGG Chr7:108976958..108976977 60.19 55
upstream ENSMUSE00000222777 Chr7:108976713..108976802 TGTGTTTGGGACATTTGAGG Chr7:108976746..108976765 59.39 45
upstream ENSMUSE00000222765 Chr7:108975954..108976067 CGAAGCCATTGTGAAGACAG Chr7:108976002..108976021 59.44 50
upstream ENSMUSE00000222759 Chr7:108975765..108975853 CTCAGAGCAGCGACAACATC Chr7:108975807..108975826 59.73 55
upstream ENSMUSE00000222753 Chr7:108975268..108975355 GTCCATGGATGGCTACGAAT Chr7:108975274..108975293 59.78 50

*** Putative Vector Insertion (Chr 7: 108975176 - 108975267) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222744 Chr7:108975020..108975175 TCATGGACTTGAGTGCAACC Chr7:108975124..108975143 59.68 50
downstream ENSMUSE00000222735 Chr7:108974707..108974785 TGCCTCTTGACACTGAAGGA Chr7:108974698..108974717 59.54 50
downstream ENSMUSE00000222727 Chr7:108974475..108974615 GTGGCTTTTCAGGCTCTTCA Chr7:108974517..108974536 60.52 50
downstream ENSMUSE00000450230 Chr7:108972407..108973073 TGTTTTGGCCATTTGCAGTA Chr7:108972544..108972563 60.11 40
downstream ENSMUSE00000222710 Chr7:108972027..108972160 CTCCTCATAGCGCTCCAAGC Chr7:108972046..108972065 62.46 60
downstream ENSMUSE00000222704 Chr7:108971175..108971917 GGAGGGAGGTGAAAACATCA Chr7:108971470..108971489 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000032737