Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9604
Trapped Gene
Shoc2 (ENSMUSG00000024976)
Vector Insertion
Chr 19: 54104469 - 54105557
Public Clones RRB022 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000146799 (Chr19:54104351..54104468 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTACCAACCTCACGCACCT Chr19:54104405..54104424 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000146799 (Chr19:54104351..54104468 +)
Downstram Exon
ENSMUSE00000391894 (Chr19:54105558..54107621 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTACCAACCTCACGCACCT Chr19:54104405..54104424 60.17 55 TGCCAGCTGTTTCAACAAAG Chr19:54106362..54106381 60.03 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688724 Chr19:54019370..54019503 TCTCTGCTTTCCTGCCTGTC Chr19:54019463..54019482 60.68 55
upstream ENSMUSE00000354840 Chr19:54061944..54062873 AAGGGAAAGACGCCAAAGAT Chr19:54062307..54062326 60.07 45
upstream ENSMUSE00000146797 Chr19:54077499..54077636 GACCTACTGGACCTCCCAGA Chr19:54077609..54077628 59.1 60
upstream ENSMUSE00000146798 Chr19:54092039..54092169 TCCAGTTTAAATCGCCTTGG Chr19:54092047..54092066 60.07 45
upstream ENSMUSE00000146794 Chr19:54100840..54101028 TGGGAGGTCCATCTCAGTTT Chr19:54100910..54100929 59.51 50
upstream ENSMUSE00000146796 Chr19:54102208..54102330 CTGGTCTCGTTTCCCTTGAG Chr19:54102311..54102330 59.84 55
upstream ENSMUSE00000146795 Chr19:54103959..54104096 AGCTACGAGAGCTGGACCTG Chr19:54104020..54104039 59.77 60
upstream ENSMUSE00000146799 Chr19:54104351..54104468 CTTACCAACCTCACGCACCT Chr19:54104405..54104424 60.17 55

*** Putative Vector Insertion (Chr 19: 54104469 - 54105557) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391894 Chr19:54105558..54107621 TGCCAGCTGTTTCAACAAAG Chr19:54106362..54106381 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr19:54104517..54104537 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACGTGACTGGGAAAACC Chr19:54104516..54104536 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024976