Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9607
Trapped Gene
Chmp4b (ENSMUSG00000038467)
Vector Insertion
Chr 2: 154518412 - 154519679
Public Clones RRB034 (baygenomics)
Private Clones OST464383 (lexicon) OST43409 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000327052 (Chr2:154518285..154518411 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGAAACAGTCCCTCTACCA Chr2:154518358..154518377 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000327052 (Chr2:154518285..154518411 +)
Downstram Exon
ENSMUSE00000399652 (Chr2:154519680..154520001 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGAAACAGTCCCTCTACCA Chr2:154518358..154518377 60.1 55 CATGCTATGCGAGAGTGAGC Chr2:154519906..154519925 59.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000393896 Chr2:154482797..154483107 AAATCGAACAGGAGCTGACG Chr2:154483054..154483073 60.4 50
upstream ENSMUSE00000385985 Chr2:154515254..154515431 CTGTCAACCATCGAGTTCCA Chr2:154515319..154515338 59.68 50
upstream ENSMUSE00000327058 Chr2:154516946..154517060 CAGCAAGAACTTGCAGAGGA Chr2:154516989..154517008 59.31 50
upstream ENSMUSE00000327052 Chr2:154518285..154518411 CCGAAACAGTCCCTCTACCA Chr2:154518358..154518377 60.1 55

*** Putative Vector Insertion (Chr 2: 154518412 - 154519679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399652 Chr2:154519680..154520001 CATGCTATGCGAGAGTGAGC Chr2:154519906..154519925 59.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCAAATGTCCCCTCCGTA Chr2:154518374..154518394 60.18 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCAAATGTCCCCTCCGTA Chr2:154518374..154518394 60.18 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038467