Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9630
Trapped Gene
Cstf3 (ENSMUSG00000027176)
Vector Insertion
Chr 2: 104489773 - 104491798
Public Clones XE087 (baygenomics) XE228 (baygenomics) XE229 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000166567 (Chr2:104489610..104489772 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACCAGACCCTGATAACCA Chr2:104489747..104489766 59.78 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000166567 (Chr2:104489610..104489772 +)
Downstram Exon
ENSMUSE00000226232 (Chr2:104491799..104491908 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACCAGACCCTGATAACCA Chr2:104489747..104489766 59.78 55 TTCTGCAAGCAGCTTACTCG Chr2:104491905..104491924 59.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376863 Chr2:104430680..104430859 TGGTGCGTACGTTGTAGTCC Chr2:104430804..104430823 59.64 55
upstream ENSMUSE00000226273 Chr2:104449028..104449129 GGTGAAGAAAGCGGAAAAGA Chr2:104449051..104449070 59.43 45
upstream ENSMUSE00000166584 Chr2:104449248..104449343 ACTTACGAACGCCTTGTTGC Chr2:104449275..104449294 60.31 50
upstream ENSMUSE00000166573 Chr2:104484446..104484478 No primer for this exon
upstream ENSMUSE00000340815 Chr2:104485136..104485233 GGGTAAACTGCCCAGCTACA Chr2:104485213..104485232 60.13 55
upstream ENSMUSE00000226254 Chr2:104486557..104486623 No primer for this exon
upstream ENSMUSE00000166559 Chr2:104486766..104486800 No primer for this exon
upstream ENSMUSE00000226243 Chr2:104486881..104487007 CGAGGTTGTGTTAATCCAATGA Chr2:104486942..104486963 59.86 40.91
upstream ENSMUSE00000166568 Chr2:104488327..104488404 No primer for this exon
upstream ENSMUSE00000166567 Chr2:104489610..104489772 GGACCAGACCCTGATAACCA Chr2:104489747..104489766 59.78 55

*** Putative Vector Insertion (Chr 2: 104489773 - 104491798) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226232 Chr2:104491799..104491908 TTCTGCAAGCAGCTTACTCG Chr2:104491905..104491924 59.51 50
downstream ENSMUSE00000166579 Chr2:104492602..104492718 AACGTGCTTATGGCTCTTTCA Chr2:104492671..104492691 59.9 42.86
downstream ENSMUSE00000166575 Chr2:104493161..104493235 CAATGTCCTCAATTGCCAGA Chr2:104493227..104493246 59.65 45
downstream ENSMUSE00000166565 Chr2:104494318..104494461 TCCATGAGGGCTGCAGTTAC Chr2:104494448..104494467 61.21 55
downstream ENSMUSE00000166560 Chr2:104495846..104495948 No primer for this exon
downstream ENSMUSE00000226206 Chr2:104499423..104499492 No primer for this exon
downstream ENSMUSE00000392214 Chr2:104500676..104500871 AAGCTGTTTCCTTGCCTTCA Chr2:104500800..104500819 59.99 45
downstream ENSMUSE00000166562 Chr2:104503451..104503604 GTGCTAAATGTCGTGGCTGA Chr2:104503607..104503626 59.87 50
downstream ENSMUSE00000166566 Chr2:104504226..104504320 GAGGTGGGAGCAGTTTCATC Chr2:104504309..104504328 59.66 55
downstream ENSMUSE00000166570 Chr2:104504454..104504514 TCCATCAGCTCATCCACTTG Chr2:104504488..104504507 59.79 50
downstream ENSMUSE00000342603 Chr2:104504874..104505575 GATGTGGCGTTGTCATTTTG Chr2:104505333..104505352 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACTGTTTAATCGCCTTGC Chr2:104489816..104489836 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGGGACTGTTCGTGACTG Chr2:104489812..104489832 59.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027176