Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9640
Trapped Gene
Ss18l1 (ENSMUSG00000039086)
Vector Insertion
Chr 2: 179789869 - 179790405
Public Clones XE680 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000227716 (Chr2:179789724..179789868 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACTGAGTCAGAGTGGTTCC Chr2:179789757..179789777 59.9 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000227716 (Chr2:179789724..179789868 +)
Downstram Exon
ENSMUSE00000227712 (Chr2:179790406..179790603 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACTGAGTCAGAGTGGTTCC Chr2:179789757..179789777 59.9 57.14 TAGTTGCTGATGGCACCTTG Chr2:179790568..179790587 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000516636 Chr2:179777214..179777573 CACTCAGCAGACCATCCAGA Chr2:179777552..179777571 59.98 55
upstream ENSMUSE00000227722 Chr2:179787169..179787245 CCTGGACTACCAGAGCAAGG Chr2:179787204..179787223 59.86 60
upstream ENSMUSE00000227719 Chr2:179788014..179788098 CACCGGAACCTGGTCTACCT Chr2:179788030..179788049 61.33 60
upstream ENSMUSE00000227716 Chr2:179789724..179789868 GCACTGAGTCAGAGTGGTTCC Chr2:179789757..179789777 59.9 57.14

*** Putative Vector Insertion (Chr 2: 179789869 - 179790405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000227712 Chr2:179790406..179790603 TAGTTGCTGATGGCACCTTG Chr2:179790568..179790587 59.86 50
downstream ENSMUSE00000488855 Chr2:179792290..179792454 CCACCCTGTGCTGAGTTGTA Chr2:179792347..179792366 59.74 55
downstream ENSMUSE00000227702 Chr2:179792793..179792894 CAGGTACTGCTGGGAAGAGC Chr2:179792815..179792834 60.01 60
downstream ENSMUSE00000227697 Chr2:179794041..179794133 AAAGGAGCGGTCGTAGCTCT Chr2:179794105..179794124 60.54 55
downstream ENSMUSE00000227693 Chr2:179796615..179796734 GTAGGTCTGCTGCTGTGCTG Chr2:179796682..179796701 59.8 60
downstream ENSMUSE00000661155 Chr2:179797976..179798103 CGTCTGCGATGTTCTGTAGC Chr2:179798064..179798083 59.62 55
downstream ENSMUSE00000573166 Chr2:179802037..179804905 ACCAGACATGTCACGCCATA Chr2:179802255..179802274 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATCGGTAACGGTGAGCAG Chr2:179789858..179789878 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATCGGTAACGGTGAGCAG Chr2:179789858..179789878 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039086