Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9646
Trapped Gene
Dusp27 (ENSMUSG00000026564)
Vector Insertion
Chr 1: 168042257 - 168057200
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) XG236 (baygenomics)
E115C12 (ggtc) E046A06 (ggtc) D073C07 (ggtc) D133B05 (ggtc) E046C03 (ggtc)
E024G10 (ggtc) E122F06 (ggtc) D098A06 (ggtc) E046A06 (ggtc) E023A04 (ggtc)
(ggtc) IST11213H10 (tigm) IST10162A4 (tigm) IST14348C12 (tigm) IST12648G10 (tigm)
IST12520F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376102 (Chr1:168057201..168057334 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCCAAACGAGGAGGATGA Chr1:168057255..168057274 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376102 (Chr1:168057201..168057334 -)
Downstram Exon
ENSMUSE00000335610 (Chr1:168042162..168042256 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCCAAACGAGGAGGATGA Chr1:168057255..168057274 60.05 50 AAGATGCTTTCGGTTTCTGC Chr1:168042196..168042215 59.46 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000429140 Chr1:168057923..168058029 CTCCCGTCCCTCTCTAGACC Chr1:168057981..168058000 60.21 65
upstream ENSMUSE00000376102 Chr1:168057201..168057334 GTTCCAAACGAGGAGGATGA Chr1:168057255..168057274 60.05 50

*** Putative Vector Insertion (Chr 1: 168042257 - 168057200) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335610 Chr1:168042162..168042256 AAGATGCTTTCGGTTTCTGC Chr1:168042196..168042215 59.46 45
downstream ENSMUSE00000399471 Chr1:168040183..168040414 TTCTCACGGACACGGTTGTA Chr1:168040290..168040309 60.15 50
downstream ENSMUSE00000160554 Chr1:168038104..168038321 GCAGAGCTTCGTCAAGGAAC Chr1:168038094..168038113 60.14 55
downstream ENSMUSE00000536048 Chr1:168028284..168031517 TTGCTCTTGGAGCGGTACTT Chr1:168030670..168030689 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGGTTAGCGGTGTCTGAG Chr1:168057160..168057180 58.92 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGGTTAGCGGTGTCTGAG Chr1:168057160..168057180 58.92 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCCTACAAAGCCTATGGAA Chr1:168057364..168057384 59.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTAAAAAGTCGGCATGCTGTT Chr1:168057316..168057337 59.77 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026564