Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI9690
Trapped Gene
Tmem170 (ENSMUSG00000031953)
Vector Insertion
Chr 8: 114390397 - 114393487
Public Clones (sanger) (sanger) (sanger) XG925 (baygenomics) G074A05 (ggtc)
IST11965C6 (tigm)
Private Clones OST424727 (lexicon) OST365394 (lexicon) OST351760 (lexicon) OST270793 (lexicon)
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306804 (Chr8:114393488..114393658 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATCGTGGGACCAATTACT Chr8:114393504..114393523 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306804 (Chr8:114393488..114393658 -)
Downstram Exon
ENSMUSE00000214928 (Chr8:114388798..114390396 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATCGTGGGACCAATTACT Chr8:114393504..114393523 59.82 50 CCCGAATGTCCAAAGAGTGT Chr8:114389330..114389349 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368043 Chr8:114400403..114400575 AACTCCACTTCGCTCTGCTC Chr8:114400411..114400430 59.75 55
upstream ENSMUSE00000306804 Chr8:114393488..114393658 GCATCGTGGGACCAATTACT Chr8:114393504..114393523 59.82 50

*** Putative Vector Insertion (Chr 8: 114390397 - 114393487) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214928 Chr8:114388798..114390396 CCCGAATGTCCAAAGAGTGT Chr8:114389330..114389349 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGGTCAAAAACGTGTAATG Chr8:114390446..114390466 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGGTCAAAAACGTGTAATG Chr8:114390446..114390466 58.94 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCCCTCACAGAGATGTGGT Chr8:114390648..114390668 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCAAACAGCATAAACGTGAC Chr8:114390602..114390623 59.79 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031953