Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI97
Trapped Gene
2810051F02Rik (ENSMUSG00000064070)
Vector Insertion
Chr 17: 12934291 - 13007361
Public Clones GC0016 (tigem) IST14414F5 (tigm) IST14606A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703803 (Chr17:12934240..12934290 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTACCACGCAGACATCCTG Chr17:12934261..12934280 59.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703803 (Chr17:12934240..12934290 +)
Downstram Exon
ENSMUSE00000495965 (Chr17:13007362..13008415 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTACCACGCAGACATCCTG Chr17:12934261..12934280 59.17 55 CCCTGTTAGGTGATGGCACT Chr17:13007599..13007618 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703803 Chr17:12934240..12934290 GTTACCACGCAGACATCCTG Chr17:12934261..12934280 59.17 55

*** Putative Vector Insertion (Chr 17: 12934291 - 13007361) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000495965 Chr17:13007362..13008415 CCCTGTTAGGTGATGGCACT Chr17:13007599..13007618 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATCCTGGGGAACTGAGGT Chr17:12961274..12961294 60.77 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGTGACTGGGAAAACC Chr17:12961338..12961358 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064070